INDEX
I. Description
III. General Considerations for Dideoxy Sequencing
IV. Radioisotope Considerations
V. Denaturation of DNA Template
V. A. Alkali Denaturation of Supercoiled Plasmid DNA
VI. Sequencing Protocol Using an End-Labeled Primer
VI. A. Primer Radiolabeling Reaction
VI. B. Annealing the Template and Primer
VI. C. Extension/Termination Reactions
VII. Sequencing Protocol Using Direct Incorporation
VII. A. Annealing the Template and Primer
VII. B. Extension/Labeling Reaction
VII. C. Termination Reaction
VIII. Preparation of Template DNA
VIII. A. Plasmid DNA
VIII. B. Single-Stranded M13 or Phagemid DNA
IX. General Considerations for Sequencing Gels
X. Troubleshooting Sequencing Reactions
XI. Appendix
XI. A. Solution Compositions
XI. B. Nucleotide Mix Formulations for Taq DNA Polymerase
XI. C. Sequencing Primers: Sequences and Applications
XI. D. Additional Sequencing Related Products
XII. References
The TaqTrack® Sequencing System is a method for enzymatic sequence analysis which takes advantage of the intrinsic properties of the DNA polymerase isolated from Thermus aquaticus ( Taq DNA Polymerase)(footnote 1). Thermus aquaticus is an extremely thermophilic microorganism whose DNA polymerase shows thermal stability to 95°C (1,2,3) . The TaqTrack® Sequencing System includes Promega's Sequencing Grade TaqDNA Polymerase (footnote 2) , which is a modified form of the enzyme that gives superior results on double-stranded DNA templates. Use of Sequencing Grade Taq DNA Polymerase results in uniform band intensity, low background and a high degree of accuracy. The high reaction temperature of the TaqTrack® Sequencing System (70°C) decreases the secondary structure of DNA templates and thus permits polymerization through highly structured regions (4). The high temperature also increases the stringency of primer hybridization. The TaqTrack® System is useful for sequencing plasmid templates and is optimized to produce readable sequence data from 10 to 500 bases. For sequencing amplified DNA and large double-stranded DNA templates such as lambda, we recommend Promega's fmol® DNA Sequencing System which uses Sequencing Grade Taq DNA Polymerase with a thermal cycle sequencing protocol.
The TaqTrack® System allows the researcher a choice of two
protocols for sequencing DNA. The end-labeled primer protocol,
a modification of that described by Heiner et al. (5)
, uses [
-32P]ATP or
[ -35S]ATP to label the sequencing primer. The DNA template and labeled
primer are annealed and an enzymatic extension/termination reaction
is then performed. This protocol is the most versatile sequencing
method and is useful when working with any template where false
priming may be a problem. We recommend the end-labeled primer
protocol when it is necessary to generate sequence data very close
to the primer.
Sequencing with 35S using the end-labeled primer protocol requires lengthy autoradiography
exposure times (4-5 days) and is not recommended. This problem
can be overcome by using a simple two-step protocol to incorporate
[
-35S]dATP into the DNA chain, which can reduce exposure times to
16-24 hours. The protocol has been used successfully with single-stranded
(ssDNA) and denatured double-stranded DNA (dsDNA) plasmid templates.
The TaqTrack® System includes 7-deaza-dGTP (footnote 3) in the nucleotide mixes in place of dGTP to aid in the resolution of band compressions. Band compressions are most often associated with GC rich sequences that form secondary structures that are not completely denatured during gel electrophoresis (6) . These secondary structures result in the anomalous migration of DNA fragments which can, in turn, complicate the interpretation of sequencing results. Incorporation of 7-deaza-dGTP destabilizes these structures and eliminates the region of band compression (7,8,9).
Sequencing primers designed for sequencing inserts in a variety of vectors are available separately. These are listed in Section XI. C .
(footnote 3) Licensed from Boehringer Mannheim GmbH under U.S. Pat. No. 4,804,748.
Product Cat.# ------------------------------------------------------------------------ TaqTrack® Sequencing System, Deaza Q5530
This system contains all of the required reagents (excluding radioisotope) for 100 sets of sequencing reactions. Includes:
100µl T4 Polynucleotide Kinase 10X Buffer
100u T4 Polynucleotide Kinase
1ml Taq DNA Polymerase 5X Buffer
500u Sequencing Grade Taq DNA Polymerase
2ml Stop Solution
100µl Each of 4 TaqTrack® Deaza d/ddNTP Mixes
2µg pUC/M13 Forward Primer (24mer)
200µl Extension/Labeling Mix, Deaza
1 Technical Manual
Product Cat.# ------------------------------------------------------------------------ TaqTrack® Sequencing Core System, Deaza Q5570
This system contains the same components as Q5530, excluding the pUC/M13 Forward Primer.
Product Cat.# ------------------------------------------------------------------------ TaqTrack® Sequencing System Deaza Reagent Kit Q5540
This system contains the same components as Q5530, excluding the pUC/M13 Forward Primer,T4 Polynucleotide Kinase and Sequencing Grade Taq DNA Polymerase.
Storage Conditions: Store all components at -20°C and keep on ice when thawed for use. When used infrequently (once a month or less), store enzymes at -70°C.
Sequencing Grade Taq DNA Polymerase is a thermostable enzyme which replicates DNA at 70°C. It is purified from Thermus aquaticus (strain YT1) and modified according to procedures developed at Promega Corporation. This enzyme preparation contains very low exonuclease activity and is free of non-specific nucleases and Taq I endonuclease. The holoenzyme (MW=85,000 daltons) is modified in vitro to produce the modified polymerase (apparent MW=80,000 daltons), which is manufactured for DNA sequencing and other related applications. Table 1 compares properties of various sequencing enzymes.
The same preparation of Sequencing Grade Taq DNA Polymerase is supplied in Promega's TaqTrack®, fmol® and SILVER SEQUENCE™ DNA Sequencing Systems.
Polynucleotide Kinase, produced by a recombinant strain of E.
coli, catalyzes the transfer of the
-phosphate from ATP to the 5´-terminus of polynucleotides
or to mononucleotides bearing a 3´-phosphate group. The enzyme
is prepared to high levels of physical and functional purity and
is routinely assayed for contaminating DNase, RNase and phosphatase
activities.
Table 1. Comparison of Sequencing Enzyme Properties .
Sequencing Rate of Exonuclease
Enzyme Processivity Incorporation Activity Templates Temp.
-------------------------------------------------------------------------------------------
Klenow Fragment low 1012dNTP/sec 3´-> 5´ DNA 37°C
-------------------------------------------------------------------------------------------
AMV Reverse moderate 4dNTP/sec none DNA & RNA 42°C
Transcriptase
-------------------------------------------------------------------------------------------
Taq DNA moderate >60dNTP/sec weak 5´-> 3´, DNA 70° -
Polymerase inactivated in 80°C
Promega's
sequencing
grade enzyme*
-------------------------------------------------------------------------------------------
Modified T7 DNA high >300dNTP/sec 3´-> 5´ DNA 37°C
Polymerase inactivated
-------------------------------------------------------------------------------------------
*The weak 5´-> 3´ exoncuclease activity of Taq DNA polymerase is not detectable in standard exonuclease assays, but the presence of this activity can be inferred from the behavior of the enzyme in other reactions (4).
A DNA sequence can be determined by chemical (10) or enzymatic (11) methods. The enzymatic method of sequencing is based on the ability of a DNA polymerase to extend a primer, hybridized to the template to be sequenced, until a chain-terminating nucleotide is incorporated. Each sequence determination is carried out as a set of four separate reactions, each of which contains all four deoxyribonucleoside triphosphates (dNTPs) supplemented with a limiting amount of one dideoxy-ribonucleoside triphosphate (ddNTP). Because the ddNTP lacks the necessary 3´-OH group required for chain elongation, the growing oligonucleotide is terminated selectively at G, A, T, or C, depending on the respective dideoxy analog in the reaction. The relative concentrations of dNTPs and ddNTPs can be adjusted to give a nested set of terminated chains from several hundred to a few thousand bases in length. The resulting fragments, each with a common origin but ending in a different nucleotide, are separated according to size by high resolution denaturing gel electrophoresis.
A variety of nucleic acid templates are suitable for sequencing. DNA inserts cloned into M13 or phagemid vectors (such as the pGEM®Zf* series) can be expressed as ssDNA molecules ideally suited for sequencing. However, recombinant plasmids also can be sequenced directly without additional subcloning or single-stranded template preparation steps. Supercoiled plasmid DNA can be alkali-denatured, annealed to a primer, and sequenced by standard dideoxy methods (12). Direct sequence analysis of DNA cloned into lambda vectors is also possible when using Sequencing Grade Taq DNA Polymerase. For best results when sequencing lambda DNA, we recommend using Promega's fmol® or SILVER SEQUENCE™ DNA Sequencing Systems.
Incorporating a radiolabel somewhere in the oligonucleotide chain
permits the visualization of the sequencing products by autoradiography.
Two basic radiolabeling protocols can be utilized to detect the
reaction products in the TaqTrack® System. The incorporation
labeling method, developed by Tabor and Richardson (13)
, separates the sequencing reaction into a labeling step and
an extension/termination step. In the first step, the primer is
extended a short distance using limiting concentrations of the
dNTPs and a single radiolabeled dNTP. In the second step, the
"extended primers" are further extended in the presence
of both dd- and dNTPs. Using the direct labeling method, a label
is attached directly to the end of the primer (5,
14,15). The oligonucleotide is 5´
endlabeled using T4 Polynucleotide Kinase and [
-32P]ATP. The subsequent extension/termination reaction is not limiting
for one of the dNTPs.
The use of an endlabeled primer affords certain advantages in sequencing. Since label is only incorporated into the specific sequencing primer, chains extended from other small DNA fragments do not contribute to background on the sequencing gel. Degradation of the sequencing products by radiolysis is not a problem when using -32P-end labeled sequencing primers. The radiolysis that does occur simply results in unlabeled fragments. The end-labeled primers and their extension products may be stored frozen at -20°C for as long as a month and still generate clear sequence data.
A disadvantage of using an 35S end-labeled primer is that very long exposure times are required (72-96 hours). This problem can be overcome by using the two-step labeling method described above. This protocol gives higher label incorporation, making overnight exposures possible when sequencing with -35S-labeled nucleotides.
* U.S. Patent No. 4,766,072 has been issued to Promega Corporation for transcription vectors having two different promoter sequences separated by a series of unique restriction sites into which foreign DNA can be inserted.
The end-labeled primer sequencing protocol is optimized for use
with [
-32P]ATP having a specific activity of 3,000Ci/mmol or greater. Higher
specific activities can be used with equivalent results, however
it may be important to utilize a carrierfree label (99% pure)
to obtain optimal results. Depending on the specific activity
of the 32P used, autoradiograms can be obtained in 2-12 hours at -70°C
with an intensifying screen. An increase in resolution can be
achieved by exposure without an intensifying screen for 12-72
hours at room temperature.
The extension/labeling protocol can be performed using either
[-35S]dATP or [ -32P]dATP. The recommended specific activities are >1,000Ci/mmol
for [-35S]dATP and 800Ci/mmol for [ -32P]dATP (at approximately 10µCi/µl). Autoradiography
exposure times are typically 16-24 hours at room temperature when
using an 35S or 32P label with the two-step protocol.
To prime efficiently, double-stranded plasmids must be converted to a single-stranded form prior to sequencing. This is accomplished by alkali denaturation of supercoiled plasmid DNA.
Reagents to Be Supplied by the User
O to a final volume of 18µl.
The end-labeled primer sequencing protocol can be divided into three steps: 1) end-labeling the sequencing primer, 2) annealing the labeled oligonucleotide and template, and 3) the extension/ termination reaction. Each step requires 10-15 minutes, not including set-up time. The TaqTrack® System has been optimized to produce readable sequence data from 10 to 500 bases from the primer with M13mp18 ssDNA as the template and a reaction temperature of 70°C. Depending on the quality of the DNA preparation, approximately 200-400 bases of readable sequence can be obtained from a dsDNA template. If an especially difficult secondary structure is encountered, increasing the reaction temperature to 80° or 85°C will facilitate polymerization through these regions, although the length of read may decrease. Sequencing Grade Taq DNA Polymerase is stable to 95°C. The TaqTrack® System uses 7-deaza-GTP in place of GTP to aid in the resolution of band compressions associated with GC-rich regions.
Reagents to Be Supplied by the User
-32P]ATP (>3,000Ci/mmol)
The following protocol is designed to label primer for 5 sets of double-stranded or 10 sets of single-stranded sequencing reactions. It can be scaled proportionately according to the number of reactions to be performed. If the volumes of the radiolabel or primer are in excess, they can be concentrated by drying in a vacuum desiccator and redissolving in the appropriate volume of water. The amount of 32P in the reaction should be doubled if the isotope has decayed by one half-life (approximately 14 days).
Different templates or sequencing strategies require various lengths
of oligonucleotide primer. Table 2 provides
a guide for determining the number of nanograms that is equivalent
to 10pmol of primer. Table 3 shows the corresponding
amounts of [
-32P]ATP to use in the kinase reaction.
1. In a microcentrifuge tube combine the following:
primer 10pmol (see Table 2) [gamma-32P]ATP 10pmol (see Table 3) Polynucleotide Kinase 10X Buffer 1µl T4 Polynucleotide Kinase (5-10u/µl) 5u ------------------------------------------------------------------- sterile dH2O to a final volume of 10µl
2. Incubate at 37°C for 10 minutes and then inactivate the Kinase at 90°C for 2 minutes.
3. Briefly centrifuge to bring down any condensation. The end-labeled primers (and their extension products) may be stored frozen at -20°C for as long as a month and still generate clear sequence data. The primer may be used directly without further purification.
Table 2. Amount of Sequencing Primer (ng) Needed to Equal 10pmol.
ng of Primer
Primer Length Equal to 10pmol
--------------------------------------------------------
15mer 50ng
16mer 53ng
17mer 56ng
18mer 59ng
19mer 63ng
20mer 66ng
24mer 80ng
1. Annealing SingleStranded DNA Template and Primer
Single-stranded DNA suitable for sequencing can be prepared from M13 or phagemid vectors (Section VIII.B). The recommended amount of ssDNA template to use per set of sequencing reactions is 0.8pmol, or approximately 2µg of an 8kb M13 template. Anneal the radiolabeled primer with the ssDNA template at a molar ratio of approximately 1:1. For each set of four sequencing reactions, mix the following reagents in a microcentrifuge tube:
ssDNA (approx. 2µg of an M13 template) 0.8pmol Taq DNA Polymerase 5X Buffer 5.0µl labeled primer (1pmol) 1.0µl -------------------------------------------------- sterile dH2O to a final volume of 25µl
Incubate at 37°C for 10 minutes. During the incubation, prepare the extension/termination reaction tubes as described in Sections VI.C.1 and 2 .
2. Annealing DoubleStranded Plasmid Template and Primer
The recommended amount of double-stranded plasmid template to use per set of sequencing reactions is 1.6pmol, or approximately 4µg of a 3-5kb plasmid vector. Prior to annealing, alkali denature and precipitate the template (Section V.A) . The radiolabeled primer is annealed with the dsDNA plasmid template in an approximately 1:1 molar ratio. For each set of four sequencing reactions, mix the following reagents in a microcentrifuge tube:
denatured plasmid dsDNA (approx. 4µg of a 35kb template) 1.6pmol Taq DNA Polymerase 5X Buffer 5.0µl labeled primer (2pmol) 2.0µl -------------------------------------------------------- sterile dH2O to a final volume of 25µl
Incubate at 37°C for 10 minutes. During the incubation, prepare the extension/termination reaction tubes as described in Sections VI.C.1 and 2 .
General Formulas to Calculate Amount of Template Equivalent to 1pmol.
ssDNA: 1pmol = (3.3 x 10^-4µg) x n
where n is the number of bases in the template
dsDNA: 1pmol = (6.6 x 10^-4µg) x n
where n is the number of bases in the template
Notes:
1. Reactions can be stored overnight at -20°C or -70°C.
2. The calculated T
for a sequencing primer is often less than 70°C, the temperature
of the sequencing reaction. However, this discrepancy does not
result in interference with primer annealing and extension because
primer/template complexes annealed at 37°C are rapidly stabilized
by extension with Taq DNA Polymerase at that temperature.
Table 3. Amount of [
-32P]ATP Needed to Equal 10pmol.
Volume Concentration Activity ------------------------------------------------- 3.0ml 10mCi/ml 3,000Ci/mmol 5.0ml 10mCi/ml 5,000Ci/mmol 0.5ml 135mCi/ml 6,000Ci/mmol
Reagents to Be Supplied by the User
-35S]dATP (1,000Ci/mmol) or [-32P]dATP (800Ci/mmol), at 10µCi/µl
1. Annealing SingleStranded DNA Template and Primer
Single-stranded DNA can be prepared from M13 or phagemid vectors (Section VIII). Anneal the primer with ssDNA template in a molar ratio of approximately 1:1. For each set of four sequencing reactions, mix the following reagents in a microcentrifuge tube:
ssDNA (approx. 2µg of an M13 0.8pmol template) primer (approx. 8ng of a 24mer) 1.0pmol (Table 2) Taq DNA Polymerase 5X Buffer 5.0µl Extension/Labeling Mix 2.0µl -------------------------------------------------- sterile dH2O to a final volume of 25µl
Incubate at 37°C for 10 minutes. During the incubation, prepare the nucleotide tubes for the termination reaction as described in Section VII.C.1, below.
2. Annealing DoubleStranded Plasmid Template and Primer
Prior to annealing, alkali denature and precipitate the template (Section V.A). Anneal the primer with the dsDNA plasmid template in a molar ratio of approximately 1:1. For each set of four sequencing reactions, mix the following reagents in a microcentrifuge tube:
denatured plasmid dsDNA (approx. 1.6pmol 4µg of a 3-5kb template) primer (approx. 16ng of a 24mer) 2pmol (Table 2) Taq DNA Polymerase 5X Buffer 5.0µl Extension/Labeling Mix 2.0µl --------------------------------------------------- sterile dH2O to a final volume of 25µl
Incubate at 37°C for 10 minutes. During the incubation, prepare the nucleotide tubes for the termination reaction as described in Section VII.C.1, below.
General Formulas to Calculate Amount of Template Equivalent to 1pmol.
ssDNA: 1pmol = (3.3 x 10^-4µg) x n
where n is the number of bases in the template
dsDNA: 1pmol = (6.6 x 10^-4µg) x n
where n is the number of bases in the template
-35S]dATP (1,000Ci/mmol, approximately 10µCi/µl) or 0.5µl
of [ -32P]dATP (800Ci/mmol, approximately 10µCi/µl) to the annealed
primer/template mixture.
Note: The extension/labeling reaction is carried out at 37°C rather than 70°C to slow down the incorporation rate of Taq DNA Polymerase and thereby limit the number of bases incorporated in this step. The incorporation of nucleotides is also limited by the limiting concentration of nucleotides present.
Notes:
1. Reactions can be stored overnight at -20°C or -70°C.
[ -35S]dATP labeled reactions can be stored at -20°C for 2-4 weeks.
2. The calculated T
for a sequencing primer is often less than 70°C, the temperature
of the sequencing reaction. However, this discrepancy does not
result in interference with primer annealing and extension because
primer/template complexes annealed at 37°C are rapidly stabilized
by extension with Taq DNA Polymerase at that temperature.
Small-scale purifications of plasmid DNA, better known as minipreps, are commonly used by most molecular biology laboratories. A standard plasmid miniprep procedure, which takes 30-60 minutes to perform, is described in Promega's Protocols and Applications Guide . Over the years a number of miniprep protocols have been used, but few have proven to be consistently reliable.
Promega's Wizard™ Minipreps, Maxipreps and Megapreps DNA Purification Systems provide an alternative method which eliminates many of the problems associated with standard miniprep procedures. The entire miniprep process can be completed in 15 minutes or less, with no organic extractions or ethanol precipitations. For convenience and efficiency, a vacuum manifold, such as Promega's Vac-Man™ Laboratory Vacuum Manifold, may be used to conveniently process multiple minipreps in parallel. If a vacuum manifold is not available, the minipreps may be processed individually using disposable 3ml syringes and a microcentrifuge.
DNA is eluted from the Wizard™ Minipreps Minicolumns in water or TE buffer, free of any salt or macromolecular contaminants. The purified plasmid can be used directly for DNA sequencing without further manipulation.
Single-stranded template DNA for sequencing can be generated from fragments cloned in M13 or phagemid vectors. When M13 vectors are transformed into E. coli cells, recombinants appear as colorless "plaques" on indicator media (16) . These infected cells are not lysed or killed by the phage. The clear areas represent retarded growth of the E. coli, which appears as a plaque when surrounded by faster growing uninfected cells. Infected cells from such colorless "plaques" are grown up to produce single-stranded template for the sequencing reaction. A protocol for the preparation of M13 single-stranded template is provided in Promega's Protocols and Applications Guide.
Phagemids are plasmid cloning vectors which contain the origin of replication from the filamentous bacteriophage f1. ssDNA can be produced from any of the pGEM®-Zf(+/-) series of phagemid vectors. The orientation of the f1 origin, designated by (+) or (-), determines which of the two strands of the plasmid will be packaged. For induction of ssDNA replication, bacterial cells containing pGEM®-Zf(+/-) recombinants are infected with an appropriate helper phage. The plasmid then enters the f1 replication mode and the resulting ssDNA is exported as an encapsidated virus-like particle. Streptavidin MagneSphere® Paramagnetic Particles Plus M13 Oligo or Wizard™ M13 DNA Purification System can be used to purify ssDNA. Alternatively, ssDNA can be purified through precipitation and extraction procedures, which are described in detail in Promega's Protocols and Applications Guide.
The DNA products of sequencing reactions separate in denaturing polyacrylamide gels as a function of the log of their molecular weight. As a result, the distance between smaller fragments is greater than that of larger fragments. The rate of migration of DNA fragments in the gel is a function primarily of the voltage gradient (volts/cm of gel length). Thus, longer gels require a greater voltage to achieve a given speed of separation. The amount of heat generated during the run is dependent on the current (amps) used. A good strategy is to run gels at constant power rather than constant voltage or current. Since power is the product of voltage and current (watts = volts x amps), this strategy prevents large voltage spikes or excessive heating from occurring. The power is typically adjusted to maintain the run temperature at 40-45°C, which is very warm or hot to the touch. This temperature is hot enough to keep DNA fragments denatured without cracking the gel plates or decomposing the polyacrylamide gel matrix.
It is essential to use only ultrapure reagents in preparing DNA sequencing gels. Promega's Acryl-a-Mix® 6 and Acryl-a-Mix® 8 pre-mixed sequencing solutions are convenient alternatives to preparing your own 6% and 8% gel solutions. The researcher need only add 10% ammonium persulfate to the pre-mixed acrylamide solution and pour the gel directly from the bottle. Table 4, below, provides recipes for a range of sequencing gels for those who prefer to prepare their own solutions. The sizes of DNA fragments comigrating with the bromophenol blue and xylene cyanol tracking dyes in various percentage polyacrylamide gels are listed in Table 5.
The rate of polymerization of the gel is a function of the acrylamide
concentration, the catalyst concentration and the ambient temperature.
The TEMED and ammonium persulfate catalysts should be thoroughly
mixed with the acrylamide solution to ensure homogeneous polymerization,
and gels should be allowed to polymerize for at least 1 hour.
Polymerization is inhibited by O
.
A more uniform spacing of gel bands can be achieved by using wedge-shaped gel spacers (slightly wider at the bottom), by pouring buffer gradient gels (higher salt concentration towards the bottom), or by adding sodium acetate to the lower buffer chamber. The effect of these techniques is to alter the voltage gradient in the gel such that smaller bands migrate more slowly. As a result, more sequence information can be read from a single autoradiogram.
Table 4. Components of Sequencing Gel Solutions (100ml).
Gel Acryl- Bis-Acryl TBE Deionized % amide amide Urea 10X Buffer H2O 10% AP* TEMED ---------------------------------------------------------------------------------------- 6% 5.7g 0.3g 42g 10ml to 100ml 500µl 50µl 8% 7.6g 0.4g 42g 10ml to 100ml 500µl 50µl 10% 9.5g 0.5g 42g 10ml to 100ml 500µl 50µl 12% 11.4g 0.6g 42g 10ml to 100ml 500µl 50µl 16% 15.2g 0.8g 42g 10ml to 100ml 500µl 50µl 20% 19.0g 1.0g 42g 10ml to 100ml 500µl 50µl
*10% ammonium persulfate should be made fresh weekly in deionized
HO and stored at 4°C.
Because of the high urea concentration in a sequencing gel, urea will tend to diffuse into the sample wells and, because of its high density, interfere with sample loading. Sample wells should be flushed with gel buffer just before the samples are loaded.
Table 5. Migration of Tracking Dyes in Denaturing Polyacrylamide Gels.
Comigrating DNA Fragment Size
Bromophenol Xylene
Gel % Blue Cyanol
---------------------------------------------
6% 26bp 106bp
8% 19bp 70-80bp
10% 12bp 55bp
20% 8bp 28bp
A number of factors can cause anomalous migration of DNA fragments in sequencing gels. Since the temperature of the gel affects its conductivity and the uniformity of the voltage gradient, the mobility of bands depends on uniform heat distribution. This can be achieved with a circulating buffer chamber or by placing an aluminum plate in contact with the gel plate. If a detachable aluminum plate is used, it should be placed behind the gel to minimize the risk of electrical shock.
Excessive salt in the sample also can lead to a variety of problems, including slower migration, lanes with a pinched appearance, smeared lanes or a significantly arched dye front across the gel.
Symptoms Possible Causes Comments
-------------------------------------------------------------------------------------------
Faint bands or no bands, Insufficient or dirty Prepare new template DNA or
even when known DNA template template DNA use a larger amount of DNA.
is used
-------------------------------------------------------------------------------------------
Insufficient enzyme activity The performance of
Sequencing Grade Taq
Polymerase is guaranteed for
2 years. Check the
expiration date on the tube
label to verify that it is
not too old.
-------------------------------------------------------------------------------------------
Isotope too old Use fresh isotope. 32P
should be used within 2
weeks. 35S can be used
as long as 2 months if
stored at -70°C.
-------------------------------------------------------------------------------------------
Poor annealing of primer to Verify that the primer
template. sequence is correct for the
template DNA.
-------------------------------------------------------------------------------------------
Make sure the primer does
not self-anneal or form
hairpin structures.
-------------------------------------------------------------------------------------------
Contamination of sequencing If possible, check the
reaction with protein or salt A260/A280 ratio. This should
be 1.8-2.0. If lower,
re-extract with phenol.
Excess salt can be removed
by reprecipitating with
ethanol and then washing the
pellet with 70% ethanol
before drying.
-------------------------------------------------------------------------------------------
Samples not denatured before Make sure samples are
loading on gel properly heat denatured
-------------------------------------------------------------------------------------------
Low band intensity at bottom When using a twostep Raise the DNA concentration
of gel. extension/ labeling protocol, 2- to 3fold.
bands at the bottom of the
gel are inherently fainter
because shorter fragments
have incorporated less
isotope. Several procedural
modifications can lead to
increased termination and
thus darker bands closer to
the primer.
-------------------------------------------------------------------------------------------
Check that the labeling
reaction contains the
correct dNTP concentrations.
-------------------------------------------------------------------------------------------
Reduce the concentration of
the dNTP Extension Mix
2-fold in the labeling
reaction.
-------------------------------------------------------------------------------------------
Reduce the labeling reaction
time to 1-2 minutes.
-------------------------------------------------------------------------------------------
Short read length or faint When short read length occurs Use only high quality pipet
bands, occurring in isolated only in isolated lanes, tips, mix well at all steps,
lanes premature termination may be and spin tubes briefly after
caused by poor pipetting or adding reagents to ensure
mixing. that no liquid remains on
the tube walls.
-------------------------------------------------------------------------------------------
High background in each lane Contamination of template
or a smear of uniform with RNA. Prepare new
intensity down each lane template.
-------------------------------------------------------------------------------------------
Contamination of template Prepare new template.
with PEG
-------------------------------------------------------------------------------------------
Problem with isotope Use fresh isotope. 32P
should be used within 2
weeks. 35S can be used
as long as 2 months if
stored at -70°C.
-------------------------------------------------------------------------------------------
Bands are fuzzy throughout Dirty template DNA. Prepare new template DNA.
the lanes.
-------------------------------------------------------------------------------------------
Poor quality polyacrylamide Prepare fresh acrylamide and
gel buffer solutions using
high-quality reagents. Store
solutions at 4°C in the
dark.
-------------------------------------------------------------------------------------------
Electrophoresis temperature Run gel at lower temperature
too high (40-60°C).
-------------------------------------------------------------------------------------------
Signal quenching due to Soak the gel in fresh 10%
inadequate acetic acid/10% methanol for
post-electrophoretic fixing 30 minutes prior to drying
of the gel when using the gel. Place the dried gel
35S label in direct contact with the
film.
-------------------------------------------------------------------------------------------
Bands are fuzzy in certain Poor contact of film with gel Make sure film is clamped
areas of gel. tightly to gel.
-------------------------------------------------------------------------------------------
Wrinkle in dried gel. Be very careful to avoid
wrinkles when drying gel.
-------------------------------------------------------------------------------------------
Bands at the same position DNA sample contains two Prepare new template DNA,
in two or three lanes different templates, starting with a single
occurring throughout the gel generating overlapping plaque or colony.
sequences
-------------------------------------------------------------------------------------------
Primer hybridizing to a Increase stringency of
secondary site annealing or make a new
primer.
-------------------------------------------------------------------------------------------
Priming occurring at nicks or Use an end-labeled primer.
gaps in dsDNA template or at DNA chains extended from
contaminating DNA fragments nicks, gaps or contaminating
fragments will not be
labeled.
-------------------------------------------------------------------------------------------
Prepare new template DNA.
-------------------------------------------------------------------------------------------
When non-sequencing grade Taq Use Promega's Sequencing
DNA Polymerase is used to Grade Taq DNA Polymerase,
sequence double-stranded which has been specifically
template using the two-step modified to remove 5´-> 3´
extension/labeling protocol, exonuclease activity.
residual 5´-> 3´ exonuclease
activity can lead to ghost
bands.
-------------------------------------------------------------------------------------------
Bands in the same position Dirty template DNA Prepare new template DNA.
in all four lanes, occurring
throughout the gel
-------------------------------------------------------------------------------------------
DNA template is nicked or Remove nicked DNA by
contaminated with PEG. acid-phenol extraction.
Remove excess PEG by
reprecipitating with
ethanol. Resuspend pellet in
10mM Tris-HCl, pH 7.6, and
extract with chloroform,
then ethanol precipitate the
aqueous phase.
-------------------------------------------------------------------------------------------
Anomalous spacing of bands, Band compression: a newly Increase the temperature of
missing bands, and bands at synthesized DNA strand is gel electrophoresis.
the same position in two or forming secondary structure
three lanes, occurring only during gel electrophoresis,
at specific regions leading to anomalous
migration.
-------------------------------------------------------------------------------------------
Prepare the sequencing gel
with 40% formamide.
-------------------------------------------------------------------------------------------
Bands in all four lanes, Dissociation of enzyme from Perform a chase step to help
occurring at specific DNA template due to secondary eliminate false bands. After
regions structure in template the termination reaction,
cool the tubes to room
temperature, add either
dNTPs (2mM each) or an
aliquot of the appropriate
DNA polymerase (0.5-1.0
unit/tube) and incubate for
15 minutes at the
appropriate sequencing
temperature. Add Stop
Solution after the chase
step.
TBE 10X Buffer:
0.89M Tris-base
0.89M boric acid
20mM EDTA
The pH should be 8.0.
Polynucleotide Kinase (PNK)
10X Buffer (supplied):
500mM Tris-HCl, pH 7.5
100mM MgCl2
50mM DTT
1.0mM spermidine
Taq DNA Polymerase 5X Buffer(supplied):
250mM Tris-HCl, pH 9.0 at 25°C
50mM MgCl2
Stop Solution (supplied):
10mM NaOH
95% formamide
0.05% bromophenol blue
0.05% xylene cyanol
Extension/Labeling Mix:
7.5µM each of dGTP, dTTP, dCTP
Nucleotide Mix Formulation:
G A T C
Nucleotide Nucleotide Nucleotide Nucleotide
Component Mix Mix Mix Mix
----------------------------------------------------------------------------
ddGTP 25µM -- -- --
ddATP -- 350µM -- --
ddTTP -- -- 300µM --
ddCTP -- -- -- 160µM
7deaza dGTP 25µM 250µM 250µM 250µM
dATP 250µM 25µM 250µM 250µM
dTTP 250µM 250µM 25µM 250µM
dCTP 250µM 250µM 250µM 25µM
The primers described below are designed for sequencing inserts in a variety of vectors. Each pBR322 primer anneals to a region flanking one of four separate cloning sites: EcoR I/Hin d III, Pst I, Sal I, or BamH I. The SP6, T7 and T3 Sequencing Primers anneal to promoter sites flanking the multiple cloning regions of pGEM® and pGEMEX® vectors. The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC vectors developed by Messing (17) , and also can be used for sequencing other lacZ containing plasmids such as the pGEM®-Z and pGEM®-Zf vectors. The Luciferase Reporter Vector Primers, GLprimer1 and GLprimer2, are designed for sequencing inserts in Promega's series of Luciferase Reporter Vectors.
Primer Sequence Size Cat.# ------------------------------------------------------------------------------ pBR322 Primers EcoR I (cw), 16mer 5´-d(GTATCACGAGGCCCTT)-3´ 2µg Q5311 Hind III (ccw), 16mer 5´-d(GCAATTTAACTGTGAT)-3´ 2µg Q5321 Pst I (cw), 16mer 5´-d(GCTAGAGTAAGTAGTT)-3´ 2µg Q5331 Pst I (ccw), 15mer 5´-d(AACGACGAGCGTGAC)-3´ 2µg Q5341 Sal I (cw), 15mer 5´-d(ATGCAGGAGTCGCAT)-3´ 2µg Q5351 Sal I (ccw), 15mer 5´-(AGTCATGCCCCGCGC)-3´ 2µg Q5361 BamH I (cw), 20mer 5´-d(CACTATCGACTACGCGATCA)-3´ 2µg Q5371 BamH I (ccw), 16mer 5´-d(ATGCGTCCGGCGTAGA)-3´ 2µg Q5381 ------------------------------------------------------------------------------ SP6/T7 Primers SP6 Promoter, 19mer 5´-d(GATTTAGGTGACACTATAG)-3´ 2µg Q5011 T7 Promoter, 20mer 5´-d(TAATACGACTCACTATAGGG)-3´ 2µg Q5021 T3 Promoter, 20mer 5´-d(ATTAACCCTCACTAAAGGGA)-3´ 2µg Q5741 ------------------------------------------------------------------------------ pUC/M13 Primers pUC/M13 forward, 17mer 5´-d(GTTTTCCCAGTCACGAC)-3´ 2µg Q5391 pUC/M13 reverse, 17mer 5´-d(CAGGAAACAGCTATGAC)-3´ 2µg Q5401 pUC/M13 forward, 24mer 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´ 2µg Q5601 pUC/M13 reverse, 22mer 5´-d(TCACACAGGAAACAGCTATGAC)-3´ 2µg Q5421 ------------------------------------------------------------------------------ Luciferase Reporter Vector Primers GLprimer1 (cw), 23mer 5´-d(TGTATCTTATGGTACTGTAACTG)-3´ 2µg E1651 GLprimer2 (ccw), 23mer 5´-d(CTTTATGTTTTTGGCGTCTTCCA)-3´ 2µg E1661 -------------------------------------------------------------------------------------------
cw = clockwise
ccw = counterclockwise
Promega also offers Custom Oligonucleotide Synthesis. Please call our Technical Services Department at 800-356-9526 (in the USA) or 608-274-4330 for details.
Product Cat.# ------------------------------------------------------------------ fmol® DNA Sequencing System Q4100
This system provides sufficient reagents for 100 sets of thermocycle sequencing reactions.
Product Cat.# ------------------------------------------------------------------ SILVER SEQUENCE™ DNA Sequencing System Q4130
This system contains sufficient reagents for 100 sets of sequencing reactions and staining reagents for 10 gels.
Product Size Cat.#
------------------------------------------------------------------
Sequencing Grade Taq DNA Polymerase 100u M2031
500u M2032
(5 x 100u)
2,500u M2036
(25 x 100u)
2,500u M2037
(5 x 500)
------------------------------------------------------------------
Product Size Cat.#
------------------------------------------------------------------
Acryl-a-Mix® 6 450ml Q7001
(6% Sequencing Solution) (6 x 75ml)
------------------------------------------------------------------
Acryl-a-Mix® 8 450ml Q7011
(8% Sequencing Solution) (6 x 75ml)
------------------------------------------------------------------
Acrylamide 100g V3111
500g V3112
(5 x 100g)
------------------------------------------------------------------
Ammonium Persulfate 25g V3131
125g V3132
(5 x 25g)
------------------------------------------------------------------
Bisacrylamide 25g V3141
125g V3142
(5 x 25g)
------------------------------------------------------------------
TEMED 50ml V3161
250ml V3162
(5 x 50ml)
------------------------------------------------------------------
Urea 1kg V3171
5kg V3172
(5 x 1kg)
Product Cat.# ------------------------------------------------------------------ Wizard™ Minipreps DNA Purification System A7100
This system contains all the reagents required for 50 plasmid minipreps.
Product Cat.# ------------------------------------------------------------------ Wizard™ Maxipreps DNA Purification System A7270
This system contains sufficient reagents and columns for 10 isolations, each from 100-500ml of bacterial culture.
Product Cat.# ------------------------------------------------------------------ Wizard™ Megapreps DNA Purification System A7300
This system contains sufficient reagents and columns for 5 isolations, each from 600-1,000ml of bacterial culture.
Product Cat.# ------------------------------------------------------------------ Wizard™ M13 DNA Purification System A7630
This system contains sufficient reagents for 50 single-stranded DNA minipreps.
Product Cat.# ------------------------------------------------------------------ Streptavidin MagneSphere® Paramagnetic Z5392 Particles Plus M13 Oligo
1. Mead, D. et al. (1988) Promega Notes 16, Promega Corporation.
2. Chien, A. et al. (1976) J. Bacteriol. 127 , 1550.
3. Kaledin, A.S. et al. (1980) Biokhimiya 45 , 494.
4. Innis, M.A. et al. (1988) Proc. Natl. Acad. Sci. USA 85, 9436.
6. Mills, D.R. and Kramer, F.R. (1979) Proc. Natl. Acad. Sci. USA 76, 2232.
7. Mizusawa, S. et al. (1986) Nucl. Acids Res . 14, 1319.
8. Barr, P.J. et al. (1986) BioTechniques 4, 428.
9. Seela, F. et al. (1982) Biochemistry 21, 4338.
10. Maxam, A.M. and Gilbert, W. (1977) Proc. Natl. Acad. Sci. USA 74, 560.
11. Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463.
12. Chen, E.Y. and Seeburg, P.H. (1985) DNA 4, 165.
13. Tabor, S. and Richardson, C.C. (1987) Proc. Natl. Acad. Sci. USA 84, 4767.
14. Hong, G.F. (1982) Bioscience Reports 2, 907.
15. McGraw, R.A. (1984) Anal. Biochem. 143 , 298.
16. Messing, J. (1983) Meth. Enzymol. 101 , 20.
17. Viera, J. and Messing, J. (1987) Meth. Enzymol . 153 , 3.
© 1993, Promega Corp. All Rights Reserved.
Acryl-a-Mix, fmol, MagneSphere, pGEM, pGEMEX, Promega and TaqTrack are registered trademarks of Promega Corporation. SILVER SEQUENCE, Vac-Man and Wizard are trademarks of Promega Corporation.
All prices and specifications contained in this document are subject to change without prior notice.
Part# TM015
INSTRUCTIONS FOR USE OF PRODUCTS Q5530, Q5570, AND Q5540
Revised 7/93
Go back to the Technical Document listing .