WU-BLAST 2.0 search of the National Center for Biotechnology Information's NR Protein Database.
BEAUTY post-processing provided by the Human Genome Sequencing Center, Baylor College of Medicine.
BEAUTY Reference:
Worley KC, Culpepper P, Wiese BA, Smith RF. BEAUTY-X: enhanced BLAST searches for DNA queries. Bioinformatics 1998;14(10):890-1. Abstract
Worley KC, Wiese BA, Smith RF. BEAUTY: an enhanced BLAST-based search tool that integrates multiple biological information resources into sequence similarity search results. Genome Res 1995 Sep;5(2):173-84 Abstract
processing output: cycle 1 cycle 2 cycle 3 cycle 4Repeat sequence:
SW perc perc perc query position in query matching repeat position in repeat score div. del. ins. sequence begin end (left) repeat class/family begin end (left) ID 288 0.0 0.0 0.0 SSH6H04.SEQ(1>293) 232 263 (6) + (A)n Simple_repeat 1 32 (0)Alignments:
288 0.00 0.00 0.00 SSH6H04.SEQ(1>293) 232 263 (6) (A)n#Simple_repeat 1 32 (148) 5 SSH6H04.SEQ(1>2 232 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 263 (A)n#Simple_rep 1 AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 32 Transitions / transversions = 1.00 (0 / 0) Gap_init rate = 0.00 (0 / 32), avg. gap size = 0.00 (0 / 0)Masked Sequence:
>SSH6H04.SEQ(1>293) RSACTATTGAAGATAAGAAGGGATGGATTGTCGAAGTTGATTAACAACGC GTGTTTATAATTTATAATTGTTTATTCCAATGTTATTAAACCAATTTTAA ACTGTAATAATGATTGCCCATACGAAAAATGGGCGCATATACTGTTGTTC GTTATCTAAAAGCATGTTATATGTGTAAAATGTTTTTTTTTGGATACATA TATATGTAAAATGATGTGCACGTTATAAATTNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNGCTTGTSummary:
================================================== file name: /repeatmasker/tmp/RM2seq sequences: 1 total length: 269 bp GC level: 25.00 % bases masked: 32 bp ( 11.90 %) ================================================== number of length percentage elements* occupied of sequence -------------------------------------------------- SINEs: 0 0 bp 0.00 % ALUs 0 0 bp 0.00 % MIRs 0 0 bp 0.00 % LINEs: 0 0 bp 0.00 % LINE1 0 0 bp 0.00 % LINE2 0 0 bp 0.00 % L3/CR1 0 0 bp 0.00 % LTR elements: 0 0 bp 0.00 % MaLRs 0 0 bp 0.00 % ERVL 0 0 bp 0.00 % ERV_classI 0 0 bp 0.00 % ERV_classII 0 0 bp 0.00 % DNA elements: 0 0 bp 0.00 % MER1_type 0 0 bp 0.00 % MER2_type 0 0 bp 0.00 % Unclassified: 0 0 bp 0.00 % Total interspersed repeats: 0 bp 0.00 % Small RNA: 0 0 bp 0.00 % Satellites: 0 0 bp 0.00 % Simple repeats: 1 32 bp 11.90 % Low complexity: 0 0 bp 0.00 % ================================================== * most repeats fragmented by insertions or deletions have been counted as one element The sequence(s) were assumed to be of primate origin. RepeatMasker version 07/16/2000 default ProcessRepeats version 07/16/2000 Repbase version 03/31/2000