PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:55573 Links RH41783 Homo sapiens chromosome 5, locus CMBL Pan troglodytes chromosome 5, locus CMBL Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GGTGTGGCCTTTTCTGGTCTTTG Reverse primer: TTCAGCTGTTTTGTGGCATAGAT PCR product size: 133 (bp), Homo sapiens    Homo sapiens Name: RH41783 Also known as: F15843 STS-F15843 sts-F15843 Polymorphism info:   Cross References Gene GeneID: 134147   Symbol: CMBL   Description: carboxymethylenebutenolidase homolog (Pseudomonas)   Position: 5p15.2 UniGene Hs.192586 Carboxymethylenebutenolidase homolog (Pseudomonas)   Hs.466662 Neuroblastoma, suppression of tumorigenicity 1 Mapping Information RH41783 Sequence Map: Chr 5|HuRef Map Viewer   Position: 10263958-10264090 (bp)   RH41783 Sequence Map: Chr 5|Celera Map Viewer   Position: 10317544-10317676 (bp)   RH41783 Sequence Map: Chr 5 Map Viewer   Position: 10332491-10332623 (bp)   sts-F15843 NCBI RH Map: Chr 5 Map Viewer   Position: 53.1 (cR)   Lod score: 1.07   sts-F15843 GeneMap99-GB4 Map: Chr 5 Map Viewer   Position: 38.61 (cR3000)   Lod score: 3.00   Reference Interval: D5S630-D5S478 Electronic PCR results RefSeq mRNA (1) NM_138809.3 2131 .. 2263 (133 bp)     mRNA (2) AJ278125.1 1922 .. 2054 (133 bp)   BX647141.1 1404 .. 1536 (133 bp)     Genomic (5 of 8)[Show All Hits] AC034241.4 55774 .. 55906 (133 bp)   AC012640.12 100255 .. 100387 (133 bp)   CH003452.1 10414474 .. 10414606 (133 bp)   CH003500.1 10856536 .. 10856668 (133 bp)   CH471102.2 9419976 .. 9420108 (133 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC020920.4 110020 .. 110152 (133 bp)     ESTs (5 of 47)[Show All Hits] H89338.1 5 .. 136 (132 bp)   N93586.1 106 .. 239 (134 bp)   AA083693.1 254 .. 386 (133 bp)   AA086463.1 101 .. 233 (133 bp)   AA111975.1 88 .. 220 (133 bp)     Whole Genome Shotgun sequences (4) AADD01055676.1 2342 .. 2474 (133 bp)   AADC01048767.1 22534 .. 22666 (133 bp)   AADB02008331.1 80651 .. 80783 (133 bp)   ABBA01020593.1 567259 .. 567391 (133 bp)        Pan troglodytes Name: RH41783 Polymorphism info:   Cross References Gene GeneID: 471455   Symbol: CMBL   Description: carboxymethylenebutenolidase homolog (Pseudomonas)   Position:   Mapping Information RH41783 Sequence Map: Chr 5 Map Viewer   Position: 10466226-10466358 (bp) Electronic PCR results RefSeq mRNA (1) XM_526833.2 1549 .. 1681 (133 bp)     Genomic (1) CM000319.1 10466226 .. 10466358 (133 bp)     Whole Genome Shotgun sequences (2) AADA01305398.1 10307 .. 10439 (133 bp)   AACZ02058108.1 7807 .. 7939 (133 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement