PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:26090 Links RH65094 Homo sapiens chromosome 4, locus LAP3 Macaca mulatta chromosome 5, locus LAP3 Found by e-PCR in sequences from Homo sapiens. Primer Information Forward primer: CAGCATTCCTGAAAGAATTCG Reverse primer: CCATCCCATTTATTCAAAAACC PCR product size: 246 (bp), Homo sapiens    Homo sapiens Name: RH65094 Also known as: stSG15586 Polymorphism info:   Cross References Gene GeneID: 51056   Symbol: LAP3   Description: leucine aminopeptidase 3   Position: 4p15.32 UniGene Hs.570791 Leucine aminopeptidase 3   Hs.702326 Transcribed locus, strongly similar to NP_056991.2 leucine aminopeptidase [H... Mapping Information RH65094 Sequence Map: Chr 4|HuRef Map Viewer   Position: 16963635-16963879 (bp)   RH65094 Sequence Map: Chr 4 Map Viewer   Position: 17218144-17218388 (bp)   RH65094 Sequence Map: Chr 4|Celera Map Viewer   Position: 18074042-18074286 (bp)   stSG15586 NCBI RH Map: Chr 4 Map Viewer   Position: 163 (cR)   Lod score: 1.54   stSG15586 GeneMap99-GB4 Map: Chr 4 Map Viewer   Position: 73.36 (cR3000)   Lod score: 1.26   Reference Interval: D4S412-D4S1601 Electronic PCR results RefSeq mRNA (1) NM_015907.2 1556 .. 1800 (245 bp)     mRNA (5 of 6)[Show All Hits] AF061738.1 1580 .. 1824 (245 bp)   AK022055.1 1389 .. 1633 (245 bp)   AK130293.1 1160 .. 1404 (245 bp)   BC006199.2 1348 .. 1592 (245 bp)   BC065564.1 1409 .. 1653 (245 bp)     Genomic (5 of 7)[Show All Hits] AC006160.9 100247 .. 100491 (245 bp)   CH003451.1 17306284 .. 17306528 (245 bp)   CH003499.1 17387524 .. 17387768 (245 bp)   CH471069.1 8200784 .. 8201028 (245 bp)   CM000255.1 18074042 .. 18074286 (245 bp)     ESTs (5 of 76)[Show All Hits] R69307.1 23 .. 268 (246 bp)   N36631.1 45 .. 289 (245 bp)   W52821.1 70 .. 314 (245 bp)   AA043520.1 110 .. 417 (308 bp)   AA132093.1 177 .. 421 (245 bp)     Whole Genome Shotgun sequences (4) AADD01043416.1 3388 .. 3632 (245 bp)   AADC01038864.1 138440 .. 138684 (245 bp)   AADB02006224.1 1004582 .. 1004826 (245 bp)   ABBA01032613.1 3870 .. 4114 (245 bp)        Macaca fascicularis   Polymorphism info:   Cross References UniGene Mfa.7432 Macaca fascicularis brain cDNA clone: QmoA-11343, similar to human leucine a...    Macaca mulatta Name: RH65094 Polymorphism info:   Cross References Gene GeneID: 715081   Symbol: LAP3   Description: leucine aminopeptidase   Position:   UniGene Mmu.2875 Leucine aminopeptidase Mapping Information RH65094 Sequence Map: Chr 5 Map Viewer   Position: 12423783-12424027 (bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement