PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:36194 Links A001U34 Homo sapiens chromosome 5 Pan troglodytes chromosome 5, locus FGF1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CTATGATACACAAAAAGACA Reverse primer: GCTAGTACTGAAGGTCCTT PCR product size: 162 (bp), Homo sapiens    Homo sapiens Name: A001U34 Also known as: Polymorphism info:   Cross References UniGene Hs.483635 Fibroblast growth factor 1 (acidic)   Hs.596951 Transcribed locus Mapping Information A001U34 Sequence Map: Chr 5|HuRef Map Viewer   Position: 137119517-137119678 (bp)   A001U34 Sequence Map: Chr 5|Celera Map Viewer   Position: 138053111-138053272 (bp)   A001U34 Sequence Map: Chr 5 Map Viewer   Position: 141951970-141952131 (bp)   A001U34 NCBI RH Map: Chr 5 Map Viewer   Position: 891.6 (cR)   Lod score: 1.03   A001U34 GeneMap99-GB4 Map: Chr 5 Map Viewer   Position: 527.55 (cR3000)   Lod score: 0.06   Reference Interval: D5S500-D5S436 Electronic PCR results Genomic (5 of 12)[Show All Hits] X59065.1 3407 .. 3568 (162 bp)   G06594.1 2909 .. 3070 (162 bp)   G19666.1 1 .. 162 (162 bp)   AC005370.1 66771 .. 66932 (162 bp)   AC010489.4 100066 .. 100227 (162 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC016560.9 179740 .. 179901 (162 bp)     ESTs (5 of 29)[Show All Hits] F02662.1 41 .. 201 (161 bp)   F02663.1 43 .. 203 (161 bp)   R36851.1 51 .. 212 (162 bp)   R42395.1 53 .. 215 (163 bp)   R42640.1 55 .. 218 (164 bp)     Whole Genome Shotgun sequences (4) AADD01064067.1 3149 .. 3310 (162 bp)   AADC01055558.1 97989 .. 98150 (162 bp)   AADB02009564.1 2264928 .. 2265089 (162 bp)   ABBA01026373.1 45197 .. 45358 (162 bp)        Pan troglodytes Name: A001U34 Polymorphism info:   Cross References Gene GeneID: 462158   Symbol: FGF1   Description: fibroblast growth factor 1 (acidic)   Position:   Mapping Information A001U34 Sequence Map: Chr 5 Map Viewer   Position: 144405678-144405839 (bp) Electronic PCR results RefSeq mRNA (5 of 8)[Show All Hits] XM_001153355.1 3599 .. 3760 (162 bp)   XM_001153420.1 3620 .. 3781 (162 bp)   XM_001153487.1 3519 .. 3680 (162 bp)   XM_001153551.1 3487 .. 3648 (162 bp)   XM_001153608.1 3715 .. 3876 (162 bp)     Genomic (3) AC160021.3 152623 .. 152784 (162 bp)   AC183921.2 1950 .. 2111 (162 bp)   CM000319.1 144405678 .. 144405839 (162 bp)     Whole Genome Shotgun sequences (2) AADA01104585.1 1672 .. 1833 (162 bp)   AACZ02064793.1 1893 .. 2054 (162 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement