PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:13845 Links RH69582 Homo sapiens chromosome 2 Macaca mulatta chromosome 12, locus LOC697935 Pan troglodytes chromosome 2B, loci LOC738490 and ACVR1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: AGCTCCATTTACTGGAAGGAC Reverse primer: TTGTGTGGCCTAAGAAAGTC PCR product size: 160 (bp), Homo sapiens GenBank Accession: N38953    Homo sapiens Name: RH69582 Also known as: N38953 Polymorphism info:   Cross References UniGene Hs.659280 Transcribed locus Mapping Information RH69582 Sequence Map: Chr 2|HuRef Map Viewer   Position: 150606536-150606694 (bp)   RH69582 Sequence Map: Chr 2|Celera Map Viewer   Position: 152334346-152334504 (bp)   RH69582 Sequence Map: Chr 2 Map Viewer   Position: 158429883-158430041 (bp)   N38953 NCBI RH Map: Chr 2 Map Viewer   Position: 1116.4 (cR)   Lod score: 2.79   N38953 GeneMap99-GB4 Map: Chr 2 Map Viewer   Position: 521.12 (cR3000)   Lod score: 0.94   Reference Interval: D2S298-D2S284 Electronic PCR results Genomic (5 of 7)[Show All Hits] AC013731.10 100049 .. 100207 (159 bp)   CH003449.1 149732749 .. 149732907 (159 bp)   CH003497.1 160341119 .. 160341277 (159 bp)   CH471058.2 26524149 .. 26524307 (159 bp)   CM000253.1 152334346 .. 152334504 (159 bp)     ESTs (1) N38953.1 168 .. 327 (160 bp)     Whole Genome Shotgun sequences (4) AADD01024035.1 1487 .. 1645 (159 bp)   AADC01020937.1 1400 .. 1558 (159 bp)   AADB02002444.1 10810 .. 10968 (159 bp)   ABBA01004847.1 429528 .. 429686 (159 bp)        Macaca mulatta Name: RH69582 Polymorphism info:   Cross References Gene GeneID: 697935   Symbol: LOC697935   Description: similar to activin A type I receptor precursor   Position:   Mapping Information RH69582 Sequence Map: Chr 12 Map Viewer   Position: 21458690-21458848 (bp)    Pan troglodytes Name: RH69582 Polymorphism info:   Cross References Gene GeneID: 470565   Symbol: ACVR1   Description: activin A receptor, type I   Position:   Gene GeneID: 738490   Symbol: LOC738490   Description: hypothetical protein LOC738490   Position:   Mapping Information RH69582 Sequence Map: Chr 2B Map Viewer   Position: 162488845-162489003 (bp) Electronic PCR results Genomic (1) CM000316.1 162488845 .. 162489003 (159 bp)     Whole Genome Shotgun sequences (2) AADA01028330.1 364 .. 522 (159 bp)   AACZ02027485.1 364 .. 522 (159 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement