PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:42146 Links WIAF-2547 Homo sapiens chromosome 3, locus IFT57 Macaca mulatta chromosome 2, locus IFT57 Pan troglodytes chromosome 3, locus IFT57 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GAAGATAGATTCCCTATAAAATC Reverse primer: GCTGACACAGTCCTTTAC PCR product size: 246 (bp), Homo sapiens    Homo sapiens Name: WIAF-2547 Also known as: A007H07 Polymorphism info:   Cross References Gene GeneID: 55081   Symbol: IFT57   Description: intraflagellar transport 57 homolog (Chlamydomonas)   Position: 3q13.12 UniGene Hs.412196 Intraflagellar transport 57 homolog (Chlamydomonas) Mapping Information WIAF-2547 Sequence Map: Chr 3|HuRef Map Viewer   Position: 105253983-105254228 (bp)   WIAF-2547 Sequence Map: Chr 3|Celera Map Viewer   Position: 106277358-106277603 (bp)   WIAF-2547 Sequence Map: Chr 3 Map Viewer   Position: 109363429-109363674 (bp)   A007H07 NCBI RH Map: Chr 3 Map Viewer   Position: 869.3 (cR)   Lod score: 1.41   A007H07 GeneMap99-GB4 Map: Chr 3 Map Viewer   Position: 391.45 (cR3000)   Lod score: 0.08   Reference Interval: D3S1302-D3S1610 Electronic PCR results RefSeq mRNA (1) NM_018010.2 1708 .. 1953 (246 bp)     mRNA (1) AF139576.1 1708 .. 1953 (246 bp)     Genomic (5 of 7)[Show All Hits] AC012020.17 151371 .. 151616 (246 bp)   CH003450.1 105542298 .. 105542543 (246 bp)   CH003498.1 113638040 .. 113638285 (246 bp)   CH471052.2 14463028 .. 14463273 (246 bp)   CM000254.1 106277358 .. 106277603 (246 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AC019297.4 100205 .. 100450 (246 bp)   AC019003.3 124 .. 369 (246 bp)   AC130409.1 77241 .. 77486 (246 bp)     ESTs (5 of 8)[Show All Hits] T90992.1 45 .. 292 (248 bp)   R96582.1 10 .. 255 (246 bp)   R98620.1 44 .. 289 (246 bp)   N34038.1 43 .. 287 (245 bp)   N74401.1 43 .. 288 (246 bp)     Whole Genome Shotgun sequences (4) AADD01036251.1 21382 .. 21627 (246 bp)   AADC01032268.1 96020 .. 96265 (246 bp)   AADB02004589.1 598204 .. 598449 (246 bp)   ABBA01061707.1 133284 .. 133529 (246 bp)        Macaca mulatta Name: WIAF-2547 Polymorphism info:   Cross References Gene GeneID: 705088   Symbol: IFT57   Description: intraflagellar transport 57 homolog (Chlamydomonas)   Position:   UniGene Mmu.422 Similar to estrogen-related receptor beta like 1 Mapping Information WIAF-2547 Sequence Map: Chr 2 Map Viewer   Position: 28256855-28257101 (bp)    Pan troglodytes Name: WIAF-2547 Polymorphism info:   Cross References Gene GeneID: 470877   Symbol: IFT57   Description: intraflagellar transport 57 homolog (Chlamydomonas)   Position:   Mapping Information WIAF-2547 Sequence Map: Chr 3 Map Viewer   Position: 112305601-112305846 (bp) Electronic PCR results RefSeq mRNA (1) XM_526260.2 1879 .. 2124 (246 bp)     Genomic (1) CM000317.1 112305601 .. 112305846 (246 bp)     Whole Genome Shotgun sequences (2) AADA01050309.1 70999 .. 71244 (246 bp)   AACZ02039061.1 102192 .. 102437 (246 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement