// models.wrm - main file defining tree class structures // This file is read only when starting a new database or when you select // "Read Models" or "Add Update File" from the main menu. // // all tags must appear in tags.wrm or systags.wrm // // Magic tag2 construct, such as Inside xxx ?AA // denotes a case where Inside and ?AA are read by the display code // whereas the intermediate xxx is up to the schema designer // @ is for Attach-Query ?Map No_cache // Don't cache segs for this map. Type UNIQUE Global_map Display Non_graphic // Prevents a graphic display! Title UNIQUE ?Text Flipped // Then coordinates go upwards Unit UNIQUE Text // e.g. kb, centiMorgan, MegaParsec Centre UNIQUE Float UNIQUE Float // default centre, width - else 0, 10 Extent UNIQUE Float UNIQUE Float // min, max - else min, max gene/locus Default_view UNIQUE ?View Minimal_view UNIQUE ?View // use this when >1 map displayed View ?View // Columns to display Inherits From_map UNIQUE ?Map // To locally edit Author Text // login name of who created it Main_Marker Main_Locus ?Locus // XREF Main_Marker removed to // allow tag2 system // tag2 system for items shown left of locator Map ?Map XREF Map_shown #Map_position EMBL_chromosome UNIQUE Text // Include all objects in these maps (must be mapped and have extents) Includes ?Map Contains Gene ?Gene XREF Map Gene_i ?Gene XREF IntMap Locus ?Locus XREF Map Clone ?Clone XREF Map Sequence ?Sequence XREF Map Map_shown ?Map XREF Map Section ?Section XREF Map Transcribed_gene ?Transcribed_gene XREF Map mRNA ?mRNA XREF Map Product ?Product XREF Map // OST_i ?OST XREF IntMap // tag2 system for items shown in main region #Map_position Position UNIQUE Float #Map_error Ends Left UNIQUE Float #Map_error Right UNIQUE Float #Map_error Cyto_location Text Multi_Position Float #Map_error Multi_Ends Float UNIQUE Float With UNIQUE With_locus UNIQUE ?Locus #Map_offset With_clone UNIQUE ?Clone #Map_offset // tag2 system for "burying" #Map_error Error UNIQUE Float ?Map_offset Relative #Map_position ?MultiMap Map ?Map Min Int // keep loci appearing on at least min maps. Default = 2 Anchor UNIQUE Text UNIQUE Text UNIQUE Text // Class tag1 tag2 // i.e Locus Homeology_group Homelogs // class members on different maps with the // same Anchor tag will be chained ?Primer Origin Text Type UNIQUE Oligo Motif UNIQUE Text Transposon Vector_Primer UNIQUE T7 SP6 M13 Length UNIQUE Int Clone UNIQUE ?Clone XREF Primer #Map_position Read ?Sequence XREF Primer Strand UNIQUE Forward Reverse RNAi ?RNAi XREF Primers OST ?OST XREF Primers Gene ?Gene XREF Primers Hits ?Sequence XREF Primer_hit Int UNIQUE Int ?Section Map ?Map XREF Section #Map_position Transcribed_gene ?Transcribed_gene XREF Section Sequence ?Sequence XREF Section ?LocusId Title UNIQUE Text // we need to have this class around for the webquery system ?GeneId Gene ?Gene XREF GeneId // MUST be top line to simplify transfer of data TT Title UNIQUE Text // human extracted from gene_info Summary UNIQUE Text // human extracted from locus id Proteome_summary UNIQUE Text // human extracted from locus id ID NewName ?NewName XREF GeneId // same as Locustag LocusLink ?LocusLink XREF GeneId NM_id ?GenBank XREF GeneId Related Locus ?Locus XREF GeneId Synonym Text Sequence ?Sequence XREF GeneId Product Text Predicted_gene ?Sequence XREF GeneId_pg DbXref Text Text // URL description Unigene ?Unigene XREF GeneId Confirmation UNIQUE Confirmed Not_confirmed Status UNIQUE Provisional_ref_seq Reviewed_ref_seq Predicted_ref_seq LocusLink_ref_seq Validated_ref_seq Inferred_ref_seq Model_ref_seq Position Map Text Cytogenetic Text Text IntMap ?Map UNIQUE Int UNIQUE Int // from NCBI gene2refseq file Genetic Locus_Phenotype ?Text // Locus->phenotype but only [C.elegansII] if existing Locus_description ?Text Gene_RIF Text // goes to Gene->Locus_Phenotype OMIM ?OMIM XREF GeneId Go_b_ace ?GO_b Text Text Molecular Descriptor ?Text // wormbase:locus->geneclass->phenotype //human: refseq +proteomesummary Properties Text Go_m_ace ?GO_m Text Text Function EC_number ?Text Gene_ontology Text Text Text Text Expression Go_c_ace ?GO_c Text Text Interacts with_gene ?GeneId XREF with_gene ?Text // 150 cases with_geneBox ?Gene XREF with_geneId ?Text // 150 cases with_protein ?GeneId XREF with_protein ?Text // 50 cases Reference ?Paper XREF GeneId // locus->reference ?NewName Transcribed_gene ?Transcribed_gene XREF NewName Gene ?Gene XREF NewName GeneOld ?Gene XREF NewNameOld GeneId ?GeneId XREF NewName NM_id ?GenBank XREF NewName // to consolidate across gene renamings Old_clone ?cDNA_clone XREF Old_newName ?Clone_group Contains ?cDNA_clone XREF Clone_group Text Best_match ?Text Transcribed_gene ?Transcribed_gene XREF Clone_group UNIQUE ?Sequence Gene ?Gene XREF Clone_group UNIQUE ?Sequence // tRNA UNIQUE Text // rRNA UNIQUE Text // snRNA UNIQUE Text // scRNA UNIQUE Text // misc_RNA UNIQUE Text ?cDNA_clone Read ?Sequence XREF cDNA_clone @"From_gene" Fully_sequenced ?Transcribed_gene XREF Fully_sequenced_clone Resequence r_gap // manual s_gap ?mRNA XREF Gap_clone UNIQUE Int // automatic, estimated gap Length Seq_length UNIQUE Int // bp Insert_size UNIQUE Float Text // kb = pcr - vector (200bp for yk clones) PCR_product_size UNIQUE Float Text REPEAT // text is kb Library UNIQUE ?Library WORF WORF1 Text Text // WS9 then WS100 pg-name WORF3 Text // WS100 pg-name MGC_ref HINV_libs DKFZ KIAA FLJ MGC MGC_r // MGC , MGC reference subset No_NM FLJ.1_1 // HRI+UT FLJ.1_2 // KRDI FLJ.2 // UT FLJ.3 // ?? // FLJ.4 HRI FLJ_HRIandIMS // 21791, filtered set june 20 2004 FLJ_KDRI // 397, filtered set june 20 2004 Primed_on_polyA // End of clone is the end of the full mRNA RT_PCR // if set does not count in 5p_complete by clustering Capped_5prime Confirmed CC_TSL CC_other_SL CC_stop // Begin of clone is the begin of the full mRNA CC_blast CC_cluster From_gene ?Transcribed_gene XREF cDNA_clone @"Genetic_position" Ignored_in_gene ?Transcribed_gene XREF Ignored_clone @"Genetic_position" In_mRNA ?mRNA XREF cDNA_clone In_gene ?Gene XREF Has_cDNA_clone Best__of ?mRNA XREF Best_available_clone Specific__of ?mRNA XREF Specific_clone Complete_CDS_of ?Product XREF Complete_CDS_clone Complete_CDS__of ?mRNA XREF Complete_CDS_clone // should be restricted to best product R Representative Redundant Partial Parent_clone ?cDNA_clone XREF Child_clone Child_clone ?cDNA_clone XREF Parent_clone Tracking_clone // for reconciliation, such clone will get assembled but not contribute to splicing NM_id ?GenBank XREF GB_clone Homolog_gene ?Transcribed_gene XREF Homolog_cDNA Discarded_from ?Sequence XREF Discarded_cDNA Int UNIQUE Int Clone_group UNIQUE ?Clone_group XREF Contains Hit ?Sequence Int COORD UNIQUE Int COORD Int COORD UNIQUE Int COORD Stage UNIQUE Mixed Embryo L1 L2 L3 Dauer L4 Anomalous_clone Suspected_internal_deletion ?Sequence Int // will get assembled but disregard anomalous introns Suspected_internal_deletion2 ?Sequence Int // to test cdna_flag Manual_internal_deletion ?Sequence Int // done by hand Manual_no_internal_deletion // done by hand Suspected_genomic_contamination VSim_Suspects_internal_deletion ?Sequence Int VDel ?Sequence Int UNIQUE Int UNIQUE Int UNIQUE Int Internal_priming // disregard 3p end Internal_priming_on_A_rich // 12 A in genome in the 18 bp downstream of last aligned base Internal_capping // disregard 5p end Inverted Mosaic // disregard length Possible_mosaic // added automatically during clean_up (cDNA_31) Partly_inverted // disregard length Incomplete_5p_Match UNIQUE Int // disregard length Incomplete_3p_Match UNIQUE Int // disregard length Ignore_this_clone UNIQUE Text // disregard, for example non editable Ignore_this_clone_automatic UNIQUE Text // disregard, for example non editable Unspliced_non_coding Possibly_unspliced Int // no intron et length = genome et ! in good transcript Duplicate_clone // will get assembled but disregard anomalous introns Length_anomaly UNIQUE Text UNIQUE Float UNIQUE Text UNIQUE Int UNIQUE Text Double_fuzzy // automatically set in mrnaScore Fuse_to_clone UNIQUE ?cDNA_clone Comment ?Text Hybridizes_to ?Clone XREF Positive_cDNA Hybridizes_weakly_to ?Clone XREF Weak_Positive_cDNA RNAi ?RNAi XREF cDNA_clone Image ?Url XREF cDNA_clone Previous_NewName Text Text // name in previous release, [pfam || (nothing == pseudo)] Old_newName ?NewName XREF Old_clone Int Int Int Int Int // length begin ali error quality ?Clone Sequence ?Sequence XREF Clone Main_Clone #Map_position // Contains main info on sequencing vector etc Directed_sequencing Transposon Text UNIQUE Int // Int = Positition Read ?Sequence XREF Subclone Contig ?Sequence XREF Multiplet Subclone ?Clone XREF Subclone_of Subclone_of ?Clone XREF Subclone Length Seq_length UNIQUE Int // bp Gel_length UNIQUE Float // Kb Insert_size UNIQUE Int UNIQUE Int Subclone_Length UNIQUE Int // base pair, max direct/reverse distance Gel ?Motif #Lane // Magic tag2 construct Stolen_reads ?Sequence XREF Stolen // for neighbouring cosmids, not Main_clone Vector Sequencing_Vector ?Vector UNIQUE Text // Text is the codage of the read names Cloning_Vector ?Vector UNIQUE Text // CAF uses an Int here as the cloning site position (default 1) Cutter ?Motif Primer ?Primer XREF Clone Clone_left_end ?Sequence XREF Clone_left_end Clone_right_end ?Sequence XREF Clone_right_end Map ?Map XREF Clone #Map_position Positive_cDNA ?cDNA_clone XREF Hybridizes_to Weak_Positive_cDNA ?cDNA_clone XREF Hybridizes_weakly_to Strategy MainTitle UNIQUE Text // appears as main Window title Species UNIQUE Text Genome_release UNIQUE Text Name_by UNIQUE Name_by_clone_group // default, YK clone groups Name_by_section // geographic naming Name_by_gene // phenotypic naming Statistics Nb_RefSeq UNIQUE Int UNIQUE DateType Nb_RefMrna UNIQUE Int UNIQUE DateType Nb_EST UNIQUE Int UNIQUE DateType PleaseNoGap // construct only gapless mRNAs NoWeirdIntrons // keep only gt_ag gc_ag in (green) mRNAs PleaseIntrons // construct mRNAs with at least one intron MaxIntronSize UNIQUE Int // reject long introns MinTranscriptSize UNIQUE Int // reject small mRNAs MaskFrequentWords UNIQUE Text // Mask frequent genomic 15mers against seeding hits SearchForTandemRepeats // slows the code by a factor 3 IgnoreWalls IgnoreDiscard // incorporate discarded-clones as if normal IgnorePolyAInProduct // do not search for a stop above a polyA, for anastasia MarkDoubleFuzzy StealFromPrediction AddPolyA // autoamtically add a polyA if last 6bp == A MultipleORF // look for several orfs StealUpStream // allow to steal up to 18 bp if lib = yke/ykm UseLeucine // authorization to start on ctg ttg NoKantorInfo // do not attempt to add the kantor info NoAbandon // do not abandon clones in very expressed genes AcceptNegativeIntron // allow a gap on the genome Kill_non_best_mRNA // kill non best_in_gene mrnas // the way to use the vector description is as follows // given a read, i will try to match its name against the Codage // Text to identify the sequencing vector // but you may also repeat in the read or the subclone just the // short hand identifier. // Note also the recursivity of the process: the sequencing vector // of the complete clone is the cloning vector of its direct // subclones. ?Vector Codage UNIQUE Text // may also be specified in main clone // subclones whose name match use this vector // if possible give the vector, cloning site and oligo used // if i know the full vector, i will reconstruct from that the rest Sequence UNIQUE ?Sequence // i.e. lawrist or M13, the full vector Cloning_Site UNIQUE ?Motif UNIQUE ?Motif // i.e. bamhI ecoRV, (mind the roman I) Oligo UNIQUE ?Oligo // the oligo used, if i have the vector sequence // If these data are missing, you can directly give the clipping sites // these are exactly the sequences you can read and want to clip on your abi traces Left_Motif UNIQUE Text // 12 or more bases, left of insert Followed_by_linker UNIQUE Text // linker Followed_by_polyT // clip 6 or more T just downstream of this vector Right_Motif UNIQUE Text // 12 or more bases, right of insert Position UNIQUE Int // the approximate position of the vector in the read // the approximate distance +- 20 bp facilitates the recognition of the vector site Maximal_position UNIQUE Int // never clip a vector after this position #Lane UNIQUE Bands UNIQUE Float REPEAT // In base pairs: if you prefer to minimise the ace format Band_Lengths UNIQUE Float REPEAT // in mm: if you prefer to minimise the ace format Band Float Text // if you wish to comment single band value ?Motif Site UNIQUE Text // AA or DNA or some more elaborate descriptor Match_sequence UNIQUE Text // idem for ace4 Restriction_Enzyme Isoschizomer ?Motif XREF Isoschizomer Offset UNIQUE Int Cleavage UNIQUE Text // will show the cleavage points ex: G_ACGT'C Overhang UNIQUE Int Company UNIQUE Text Redundant Remark Text Substrate UNIQUE DNA Peptide Homol DNA_homol ?Sequence XREF Motif_homol ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Pep_homol ?Protein XREF Motif_homol ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Motif_homol ?Motif XREF Motif_homol ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Product_homol ?Product ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info ?Pfam Accession ?Text Definition UNIQUE ?Text Interpro UNIQUE Text Text Text Text // not ?Text, so does not contribute to webquery GO ?GO XREF Pfam Reference Text UNIQUE Text UNIQUE Text Paper ?Paper XREF Pfam Comment UNIQUE Text Pfam_comment UNIQUE Text Interpro_comment UNIQUE Text Manual_edition Run_date UNIQUE DateType Homol Gene ?Gene XREF Pfam Product ?Product XREF Pfam @"Pfam" CDS ?Sequence XREF Pfam_homol ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info // Pfam data comes from http://pfam.wustl.edu, download the file // Pfam-A.full.gz and load it into the database. After that, download // the Interpro data and load it into the database. The Interpro data // overwrites some of the WUSTL data, but is more complete. // // The name of the Pfam object is the pfam identifier from the Pfam-A.full file. // Accession is the PF number. // Definition is a short description. // Interpro and GO come from the Interpro data. // Reference is obsolete, but some databases may still contain this data. // Paper is a list of pubmed Paper objects. // Comment is the "GF CC" description in the Pfam file, or may be supersede by // Interpro data // Manual_edition is set manually when making manual changes to a Pfam record. // After importing, "find pfam ; query manual_edition" and check all the // resulting objects for correctness. // Run_date is the date that the data was downloaded // Homol is computed by the genome pipeline. // ?Oligo Sequence UNIQUE Text // verbatim sequence Length UNIQUE Int In_sequence ?Sequence XREF Oligo OSP Score UNIQUE Float Tm UNIQUE Float Pairwise_scores ?Oligo XREF Pairwise_scores UNIQUE Float Float // score and Tm Status Temporary Ordered UNIQUE DateType //Received UNIQUE DateType ?Transcribed_gene T Transpliced_title UNIQUE Text Operon_title UNIQUE Text Antisens_title ?Transcribed_gene XREF Antisens_title // at least 100 bp Gene ?Gene XREF Transcribed_gene Locus ?Locus XREF Transcribed_gene RNA_interference ?Text Exactly_known mRNA_Length Nb_codons Total_intron_length UNIQUE Int Composite Transcribed_from Genomic_sequence UNIQUE ?Sequence XREF Transcribed_gene Covers UNIQUE Int UNIQUE Text UNIQUE Int UNIQUE Int Section UNIQUE ?Section XREF Transcribed_gene NewName UNIQUE ?NewName XREF Transcribed_gene DefinitiveName UNIQUE Text Map ?Map XREF Transcribed_gene #Map_position IntMap UNIQUE ?Map UNIQUE Int UNIQUE Int mRNA ?mRNA XREF From_gene UNIQUE Int UNIQUE Int // coords of tr in tg Product ?Product XREF From_gene Comparison_to_genome Quality UNIQUE Int Possible_SNP ?Sequence XREF Possible_SNP Possible_genomic_error ?Sequence XREF Possible_genomic_error Status Remark UNIQUE Text To_do To_be_done Edited Date UNIQUE DateType Text Submitted HINV Method AceView Bcembly GBIRC JBIRC NEDO Kent EBI FBI NCBI NCBH Splign Splign2 Unigene Smith_Waterman_done ORF UNIQUE Int Text // ORF_length "bp" Rank G_strand G_forward G_reverse Masked // falls in a hyghly polymorphic region Ali Score UNIQUE Int UNIQUE Int No_score Bad_score Local_best Best_in_method Alternate UNIQUE Int Repetition_5 UNIQUE Int Genomic_contamination ORF_bonus Identical_exon UNIQUE Int Exon_tested M_score UNIQUE Int UNIQUE Int M_range Best Best5 Best50 Best500 Best5000 M_split M_Major M_minor Alibaba ?Sequence XREF Alibaba Alibaba_old AliName UNIQUE Text // Gold or Method_title Identical_in_n UNIQUE Int Gold Gold_score UNIQUE Int Per_mille UNIQUE Int Gold_rank Excellent Diamond Good Partial Partial1 Partial2 Dubious Dubious1 Dubious2 Dubious3 Dubious4 Bad_ignored Bad Bad1 Bad2 Bad3 Bad4 Bad_short Repetition UNIQUE Int Rear Split Mosaic Inversion UNIQUE Int Transposition Fuse_with Pile_up UNIQUE Int Genome_deletion UNIQUE Int Variable_repeat UNIQUE Int Multiple Major Minor Bug Twin // please always kill one of the twins Ambiguous // aligned twice by same method Duplicate_of_read Text Bad_intron UNIQUE Int // number of non gt_ag gc_ag introns ORF_malus Int // loses because of optimal ORF Wrong_map // because an excellent gold is elsewhere Wrong_strand Dubious_strand Dubious_map_B // because a very_good gold is elsewhere Dubious_map_C // because a not_so_good gold is elsewhere Too_long More_exon UNIQUE Int More_5p UNIQUE Int More_central UNIQUE Int More_3p UNIQUE Int More_intron UNIQUE Int More_micro_indel UNIQUE Int PolyA_first_exon PolyA_exon Vector_exon Too_short_first_exon UNIQUE Int Wrong_exon Missed_exon UNIQUE Int Missed_5p UNIQUE Int Missed_central UNIQUE Int Missed_3p UNIQUE Int Text Missed_intron UNIQUE Int Missed_micro_indel UNIQUE Int Structure Nb_possible_exons UNIQUE Int Nb_alternative_exons UNIQUE Int Nb_confirmed_introns UNIQUE Int Nb_non_coding_introns UNIQUE Int Nb_confirmed_alternative_introns UNIQUE Int Total_gap_length UNIQUE Int Transpliced_to ?Motif Int COORD UNIQUE Text PolyA_after_base UNIQUE Int COORD Initial_polyA UNIQUE Int COORD UNIQUE Int // start position number of A No_5prime_read No_3prime_read Actual_gap Int Text ?cDNA_clone Complete Intron_boundaries gt_ag UNIQUE Int Int Int ?cDNA_clone // number x1 x2 support ct_ac UNIQUE Int Int Int ?cDNA_clone gc_ag UNIQUE Int Int Int ?cDNA_clone at_ac UNIQUE Int Int Int ?cDNA_clone Fuzzy UNIQUE Int Int Int ?cDNA_clone Text // type of fuzzy Other Text UNIQUE Int Int Int ?cDNA_clone V_repeat UNIQUE Int Int Int ?cDNA_clone // number x1 x2 supporting clone Longest_cDNA_clone UNIQUE ?cDNA_clone UNIQUE Int Longest_cDNA_product UNIQUE ?cDNA_clone UNIQUE Float UNIQUE Text Fully_sequenced_clone ?cDNA_clone XREF Fully_sequenced cDNA_clone ?cDNA_clone XREF From_gene @From_gene Ignored_clone ?cDNA_clone XREF Ignored_in_gene Image ?cDNA_clone @Image Read ?Sequence XREF From_gene UNIQUE Int UNIQUE Int UNIQUE Int UNIQUE Int UNIQUE Int // length offset lengthmatch err quality Homolog_cDNA ?cDNA_clone XREF Homolog_gene Clone_group ?Clone_group XREF Transcribed_gene UNIQUE Int // number of clones of that group Expression_profile Int REPEAT // sum of expression profile, each clone adds to 100 Matching_genefinder_gene ?Sequence XREF Matching_transcribed_gene Identical_to_genefinder UNIQUE ?Sequence Details Missing_read ?Sequence XREF Missing_from_gene @From_gene LostRead ?Sequence Overlaps ?Transcribed_gene XREF Overlaps Antisens_to ?Transcribed_gene XREF Antisens_to UNIQUE Int To_be_fused_with ?Transcribed_gene XREF Antisens_to UNIQUE Int Shedded_from ?Transcribed_gene XREF Sheds Sheds ?Transcribed_gene XREF Shedded_from Possible_operon ?Transcribed_gene XREF Possible_operon UNIQUE Int Next_gene_in_cis UNIQUE ?Transcribed_gene XREF Previous_gene_in_cis UNIQUE Int Previous_gene_in_cis UNIQUE ?Transcribed_gene XREF Next_gene_in_cis UNIQUE Int Splicing Int COORD Int COORD #Splicing_confirmation // do NOT say unique Assembled_from Int Int ?Sequence UNIQUE Int UNIQUE Int UNIQUE Int // a1 a2 read x1 x2 nberr ?mRNA Title UNIQUE ?Text Bad_quality Text Fiche UNIQUE ?Fiche XREF mRNA Genetic_code UNIQUE ?Genetic_code From_gene ?Transcribed_gene XREF mRNA NM_id ?GenBank XREF mRNA NM_idexported ?GenBank XREF mRNAexported NM_idaligned ?GenBank XREF mRNAaligned Genefinder From_AM From_prediction ?Sequence XREF Predicted_mRNA Matching_genefinder ?Sequence XREF Matching_mRNA Identical_to_genefinder ?Sequence XREF Identical_to_mRNA RNAi ?RNAi XREF mRNA SMAP S_Parent Genomic_sequence UNIQUE ?Sequence XREF mRNAs Covers UNIQUE Int UNIQUE Text UNIQUE Int UNIQUE Text UNIQUE Int DNA UNIQUE ?DNA UNIQUE Int Text // Int is the length Constructed_from Int Int ?Sequence XREF In_mRNA Int Int S_Child Product ?Product XREF mRNA UNIQUE Int UNIQUE Int Int UNIQUE Int @ID Position IntMap UNIQUE ?Map UNIQUE Int UNIQUE Int Map ?Map XREF mRNA #Map_position Structure Longest_ORF UNIQUE Int UNIQUE Text UNIQUE Int UNIQUE Text // 600 bp 200 AA from end to end Longest_CDS UNIQUE Int UNIQUE Text UNIQUE Int UNIQUE Text // 645 bp 215 AA from end to end Length_5prime_UTR UNIQUE Int UNIQUE Text Length_3prime_UTR UNIQUE Int UNIQUE Text Splicing Int UNIQUE Int UNIQUE Int UNIQUE Int #Splicing_confirmation Coding Int UNIQUE Int UNIQUE Int UNIQUE Int UNIQUE Text Nb_exons UNIQUE Int Nb_alternative_exons UNIQUE Int Nb_stolen_exons UNIQUE Int Nb_predicted_exons UNIQUE Int Total_gap_length UNIQUE Int Intron_boundaries gt_ag UNIQUE Int Int Int ?cDNA_clone ct_ac UNIQUE Int Int Int ?cDNA_clone gc_ag UNIQUE Int Int Int ?cDNA_clone at_ac UNIQUE Int Int Int ?cDNA_clone Fuzzy UNIQUE Int Int Int ?cDNA_clone Text // type of fuzzy Other Text UNIQUE Int Int Int ?cDNA_clone V_repeat UNIQUE Int Int Int ?cDNA_clone // number x1 x2 supporting clone Quality Score UNIQUE Int // refsequisable mrna and score Rating UNIQUE Text RefSeq Best_in_gene Low_expression Ambiguous_best_product Well_supported // cds_covered_by == 1 && cds >= 100 AA || (cds >= 50 && tax != *sapiens*) Mrna_covered_by ?Sequence // minimum covering set CDS_covered_by ?Sequence // minimum covering set RefSeqMaker UNIQUE ?Sequence XREF RefSeqMaker Tiling Tiling_gap Int Int // in mrna, in cds Tiling_error UNIQUE Int Tiling_base_error UNIQUE Int Tiling_path Int Int ?Sequence XREF mRNA_tiling Int Int To_resequence ?cDNA_clone Expression_profile Int REPEAT // sum of expression profile, each clone adds to 100 Coding_antisens_to ?mRNA XREF Coding_antisens_to Int Signature SL0 SL0_m UNIQUE Int SL0_e UNIQUE Int SL0_d UNIQUE Int SL0_L1 UNIQUE Int SL0_L2 UNIQUE Int SL0_L3 UNIQUE Int SL0_L4 UNIQUE Int SL1 SL1_m UNIQUE Int SL1_e UNIQUE Int SL1_d UNIQUE Int SL1_L1 UNIQUE Int SL1_L2 UNIQUE Int SL1_L3 UNIQUE Int SL1_L4 UNIQUE Int SL2s SL2s_m UNIQUE Int SL2s_e UNIQUE Int SL2s_d UNIQUE Int SL2s_L1 UNIQUE Int SL2s_L2 UNIQUE Int SL2s_L3 UNIQUE Int SL2s_L4 UNIQUE Int Completeness Complete // found5p && Found3p && convaincant Found5p Transpliced_to ?Motif ?cDNA_clone Aggregated_5p_clones UNIQUE Int Submitted_as_5p_complete ?cDNA_clone Found3p PolyA_primed_clone PolyA_found Int ?cDNA_clone PolyA_Signal AATAAA Int Variant Text Int Submitted_as_3p_complete ?cDNA_clone Gap Gap_length UNIQUE Int Gap_clone ?cDNA_clone XREF s_gap Int Int Int Int // gap unalignedLength 5pLength 3pLength Clones Best_available_clone ?cDNA_clone XREF Best__of Specific_clone ?cDNA_clone XREF Specific__of Complete_CDS_clone ?cDNA_clone XREF Complete_CDS__of cDNA_clone ?cDNA_clone XREF In_mRNA Int Text Int Text Float Text Int Text @Anomalous_clone // 1022 "bp measured" .9 "kb variation" -12 "%" ?Product ID Title UNIQUE ?Text // the title kernel we export to refseq Kantor_title UNIQUE ?Text // copied from kantor->title or from kantor->Kantor_title Short_kantor_title UNIQUE Text uORF Suggested_class Text // ufo nmt ... generated from kantor Blastp_title UNIQUE Text // generated from kantor Pfam_title ?Pfam REPEAT // liste des pfam Motif_title UNIQUE Text // not text it would be too much XREF'd Psort_title UNIQUE Text // not text it would be too much XREF'd Tax_common_ancestor Text Family_title UNIQUE Text Molecular_weight UNIQUE Float UNIQUE Float GeneBox ?Gene XREF Product From_gene UNIQUE ?Transcribed_gene XREF Product Genefinder From_prediction ?Sequence XREF Predicted_product Matching_gene ?Sequence XREF Matching_product Identical_to_gene ?Sequence XREF Identical_to_product Expasy UNIQUE Float UNIQUE Float Expasy_class A B B1 B2 B3 Completeness Quality UNIQUE Int Partial ?Product XREF Included_in_partial Complete ?Product XREF Included_in_complete // NH2_Complete && COOH_Complete NH2_Complete Up_stop UNIQUE Int REPEAT // negative numbers, if Met_at_position_1 Early_Met Manual_Met mRNA_5p_complete Met at_position_1 // Only possible if NH2_Complete, if present: A of ATG defines base 1 First_Met UNIQUE Int // AA units, obsolete, kept for backwards compatibility First_ATG UNIQUE Int // AA units First_NTG UNIQUE Int UNIQUE Text // AA units COOH_Complete Down_stop UNIQUE Int REPEAT Best_product // longest CDS, or if none longest ORF Good_product // has some kind of good annot or CDS >= 100 AA Open_length UNIQUE Int UNIQUE Text UNIQUE Int UNIQUE Text // 645 bp 215 AA from end to end Coding_gap UNIQUE Int UNIQUE Text UNIQUE Int UNIQUE Text // 201 bp 67 X Length_5prime_UTR UNIQUE Int UNIQUE Text Coding_length UNIQUE Int UNIQUE Text UNIQUE Int UNIQUE Text // from Met to Stop, and only if they exist Length_3prime_UTR UNIQUE Int UNIQUE Text Complete_CDS_clone ?cDNA_clone XREF Complete_CDS_of Covered_by ?Sequence XREF Covers_product UNIQUE Text UNIQUE Int UNIQUE Text UNIQUE Int UNIQUE Text // delta # nV # type Structure Introns Nb_introns_in_CDS UNIQUE Int Nb_Introns_outside_CDS UNIQUE Int Unicity Original // if complete not identical or partial not included and not identical Identical_to ?Product Included_in_complete ?Product XREF Complete Included_in_partial ?Product XREF Partial Homol AKG AceKogHuman Text UNIQUE Text // Gene NewName_or_GeneId Text, because this is an external reference AceKogWorm Text UNIQUE Text // Text, because this is an external reference AceKog Text Text Float Int UNIQUE Int Int UNIQUE Int ?Text Pfam ?Pfam XREF Product ?Method Float Int UNIQUE Int Int UNIQUE Int Text Text Blastp ?Protein ?Method Float Int UNIQUE Int Int UNIQUE Int Text // ?may be costly Domain ?Motif ?Method Float Int UNIQUE Int Int UNIQUE Int Text Nucleic_acid_binding Leucine_zipper_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text Zinc_finger_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text RNA_binding_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text Psort_domain Transmembrane_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text Cleavable_signal_peptide ?Method Float Int UNIQUE Int Int UNIQUE Int Text N_terminal_signal_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text N_terminal_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text Nuclear_localization_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text 2nd_peroximal_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text actin_binding_1_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text actin_binding_2_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text ATP_binding_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text Coiled_coil_region ?Method Float Int UNIQUE Int Int UNIQUE Int Text Coil_coil_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text Coil_coil_4 ?Method Float Int UNIQUE Int Int UNIQUE Int Text Ribosomal_protein_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text Dileucine_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text ER_membrane_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text ER_retention_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text Golgi_transport_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text N_myristoylation_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text peroxisomal_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text prenylation_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text vacuolar_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text Mitochondrial_cleavage_site_domain ?Method Float Int UNIQUE Int Int UNIQUE Int Text Tax_tree Archaea Viruses Bacteria Escherichia_coli Eukaryota Plasmodium_falciparum Mycetozoa Dictyostelium_discoideum Viridiplantae Chlamydomonas_reinhardtii Arabidopsis_thaliana Zea_mays Fungi_Metazoa_group Fungi Saccharomyces_cerevisiae Schizosaccharomyces_pombe Neurospora_crassa Metazoa Bilateria Pseudocoelomata Caenorhabditis_elegans Protostomia Mollusca Panarthropoda Anopheles_gambiae_str_PEST Drosophila_melanogaster Deuterostomia Echinodermata Chordata Vertebrata Teleostomi Teleostei Takifugu_rubripes Danio_rerio Amphibia Xenopus_laevis Amniota Mammalia Eutheria Mus_musculus Rattus_norvegicus Homo_sapiens Tax_count NArchaea UNIQUE Int NViruses UNIQUE Int NBacteria UNIQUE Int NEscherichia_coli UNIQUE Int ?Method ?Protein Float NEukaryota UNIQUE Int NPlasmodium_falciparum UNIQUE Int ?Method ?Protein Float NMycetozoa UNIQUE Int NDictyostelium_discoideum UNIQUE Int ?Method ?Protein Float NViridiplantae UNIQUE Int NArabidopsis_thaliana UNIQUE Int ?Method ?Protein Float NZea_mays UNIQUE Int ?Method ?Protein Float NChlamydomonas_reinhardtii UNIQUE Int ?Method ?Protein Float NFungi_Metazoa_group UNIQUE Int NFungi UNIQUE Int NSaccharomyces_cerevisiae UNIQUE Int ?Method ?Protein Float NSchizosaccharomyces_pombe UNIQUE Int ?Method ?Protein Float NNeurospora_crassa UNIQUE Int ?Method ?Protein Float NMetazoa UNIQUE Int NBilateria UNIQUE Int NPseudocoelomata UNIQUE Int NCaenorhabditis_elegans UNIQUE Int ?Method ?Protein Float NProtostomia UNIQUE Int NMollusca UNIQUE Int NPanarthropoda UNIQUE Int NAnopheles_gambiae_str_PEST UNIQUE Int ?Method ?Protein Float NDrosophila_melanogaster UNIQUE Int ?Method ?Protein Float NDeuterostomia UNIQUE Int NEchinodermata UNIQUE Int NChordata UNIQUE Int NVertebrata UNIQUE Int NTeleostomi UNIQUE Int NTakifugu_rubripes UNIQUE Int ?Method ?Protein Float NDanio_rerio UNIQUE Int ?Method ?Protein Float NAmphibia UNIQUE Int NXenopus_laevis UNIQUE Int ?Method ?Protein Float NAmniota UNIQUE Int NMammalia UNIQUE Int NEutheria UNIQUE Int NMus_musculus UNIQUE Int ?Method ?Protein Float NRattus_norvegicus UNIQUE Int ?Method ?Protein Float NHomo_sapiens UNIQUE Int ?Method ?Protein Float Localisation Psort Cytoplasmic UNIQUE Float // was ?Psort XREF Product // localisation de la protein Cytoskeletal UNIQUE Float Endoplasmic_reticulum UNIQUE Float Secreted UNIQUE Float // extracellular, including cell wall Golgi UNIQUE Float Mitochondrial UNIQUE Float Membrane UNIQUE Float Nuclear UNIQUE Float Peroxisomal UNIQUE Float Plasma_membrane UNIQUE Float Vacuolar UNIQUE Float Vesicles_of_secretory_system UNIQUE Float Antibody GFP_tag Frame UNIQUE Int Primers Text UNIQUE Text UNIQUE TEXT UNIQUE Float // ATGGATCAATTCCAAGCTTTGATT "(Met->24bp,T=55.1)" "osp_score" 70.0 SMAP S_Parent mRNA UNIQUE ?mRNA XREF Product From_EST UNIQUE ?Sequence XREF EST_translation Peptide UNIQUE ?Peptide UNIQUE Int UNIQUE Int // Int is the signature Source_Exons Int COORD UNIQUE Int COORD #Protein_fragment // gene splicing in bp then AA Position IntMap UNIQUE ?Map UNIQUE Int UNIQUE Int Map ?Map XREF Product #Map_position CDS Method UNIQUE ?Method // for display purposes Kantor UNIQUE ?Kantor XREF Product @Title_hints ?Psort Title ?Text // ClassK antor maintains exterior protein annotations maintained on the sole // basis of its peptide sequence, it is named based on the peptide hash-value // the searches (BLAST, PFAM etc) can be run 'in advance' of creating the Product // object and are hooked to it on the basis of the peptide sequence hash value // this is a secret class without any XREF originating from it // ace -> michel peptide product Predicted_product Representative_product // pfam -> pfam_date Pfam hit_info PFAM_title // blastp -> blastp_date title_hints blastp Blastp_title Short_title // taxblast-> taxblast_date Tax_count Tax_tree // psort -> psort_date psort domain // expasy -> expasy_date expasy ?Kantor Hand Title UNIQUE Text // hand edited out of kantor_title + GenBank Is_mrna ->Brief_identification Short_title UNIQUE Text // hand edited Auto ID Kantor_title UNIQUE Text // fully automatic Short_kantor_title UNIQUE Text // fully automatic mRNA_title UNIQUE Text Suggested_class UNIQUE Text // ufo nmt ... generated from kantor Family_title UNIQUE Text Blastp_title UNIQUE Text Taxblast_title UNIQUE Text PFAM_title UNIQUE Text Product ?Product // NO XREF Representative_product UNIQUE ?Product // NO XREF Peptide UNIQUE ?Peptide UNIQUE Int UNIQUE Int Michel UNIQUE Float UNIQUE Float Kantor_Date UNIQUE DateType EXP Expasy_Date UNIQUE DateType Expasy UNIQUE Float UNIQUE Float PFM Pfam_Date UNIQUE DateType Pfam ?Pfam ?Method Float Int UNIQUE Int Int UNIQUE Int Text Text // score,a1.a2.x1.x2,method,expect(out of range of floats) Hit_Info Pfam_Significant_Hits UNIQUE Int Pfam_Non_Significant_Hits UNIQUE Int BLP Blastp_Date UNIQUE DateType Blastp ?Protein ?Method Float Int UNIQUE Int Int UNIQUE Int Text Title_hints Text AKG AceKog_Date UNIQUE DateType AceKog Text Text Float Int UNIQUE Int Int UNIQUE Int ?Text AceKogHuman Text Text // Text, because this is an external reference AceKogWorm Text Text // Text, because this is an external reference PSR Psort_Date UNIQUE DateType Psort Localization ?Psort UNIQUE Float Domain ?Motif ?Method Float Int UNIQUE Int Int UNIQUE Int Text TXB Taxblast_Date UNIQUE DateType Tax_tree Archaea Viruses Bacteria Escherichia_coli Eukaryota Plasmodium_falciparum Mycetozoa Dictyostelium_discoideum Viridiplantae Chlamydomonas_reinhardtii Arabidopsis_thaliana Zea_mays Fungi_Metazoa_group Fungi Saccharomyces_cerevisiae Schizosaccharomyces_pombe Neurospora_crassa Metazoa Bilateria Pseudocoelomata Caenorhabditis_elegans Protostomia Mollusca Panarthropoda Anopheles_gambiae_str_PEST Drosophila_melanogaster Deuterostomia Echinodermata Chordata Vertebrata Teleostomi Teleostei Takifugu_rubripes Danio_rerio Amphibia Xenopus_laevis Amniota Mammalia Eutheria Mus_musculus Rattus_norvegicus Homo_sapiens Tax_count NArchaea UNIQUE Int NViruses UNIQUE Int NBacteria UNIQUE Int NEscherichia_coli UNIQUE Int ?Method ?Protein Float NEukaryota UNIQUE Int NPlasmodium_falciparum UNIQUE Int ?Method ?Protein Float NMycetozoa UNIQUE Int NDictyostelium_discoideum UNIQUE Int ?Method ?Protein Float NViridiplantae UNIQUE Int NChlamydomonas_reinhardtii UNIQUE Int ?Method ?Protein Float NArabidopsis_thaliana UNIQUE Int ?Method ?Protein Float NZea_mays UNIQUE Int ?Method ?Protein Float NFungi_Metazoa_group UNIQUE Int NFungi UNIQUE Int NSaccharomyces_cerevisiae UNIQUE Int ?Method ?Protein Float NSchizosaccharomyces_pombe UNIQUE Int ?Method ?Protein Float NNeurospora_crassa UNIQUE Int ?Method ?Protein Float NMetazoa UNIQUE Int NBilateria UNIQUE Int NPseudocoelomata UNIQUE Int NCaenorhabditis_elegans UNIQUE Int ?Method ?Protein Float NProtostomia UNIQUE Int NMollusca UNIQUE Int NPanarthropoda UNIQUE Int NAnopheles_gambiae_str_PEST UNIQUE Int ?Method ?Protein Float NDrosophila_melanogaster UNIQUE Int ?Method ?Protein Float NDeuterostomia UNIQUE Int NEchinodermata UNIQUE Int NChordata UNIQUE Int NVertebrata UNIQUE Int NTeleostomi UNIQUE Int NTakifugu_rubripes UNIQUE Int ?Method ?Protein Float NDanio_rerio UNIQUE Int ?Method ?Protein Float NAmphibia UNIQUE Int NXenopus_laevis UNIQUE Int ?Method ?Protein Float NAmniota UNIQUE Int NMammalia UNIQUE Int NEutheria UNIQUE Int NMus_musculus UNIQUE Int ?Method ?Protein Float NRattus_norvegicus UNIQUE Int ?Method ?Protein Float NHomo_sapiens UNIQUE Int ?Method ?Protein Float ?WbId Predicted_gene ?Sequence XREF WbId Gene ?Gene XREF WbId ?Sequence Title UNIQUE Text // absolutelly NO ?Text here, 4M est have it Product_title UNIQUE ?Text mRNA_title UNIQUE ?Text Full_name UNIQUE Text OMIM ?OMIM XREF Sequence GeneId_pg ?GeneId XREF Predicted_gene GeneId ?GeneId XREF Sequence WbId ?WbId XREF Predicted_gene COG ?COG XREF Sequence @Info GO ?GO Has_EST has_exact_est Homolog ?Text Reference ?Paper XREF Sequence DNA UNIQUE ?DNA UNIQUE Int Text // Int is the length RNA // if this tag is set display AUGC Type UNIQUE Is_read Difficult_to_align Is_ignored_read Is_contig Is_assembly Is_bac Is_AM Product Genomic Is_Cosmid In_junction ?Sequence XREF Parts Is_gene_tile // to cover large genes // Is_Link // Parts ?Sequence Junction Parts ?Sequence XREF In_junction Is_Pair Is_gap UNIQUE Int Is_chain UNIQUE Int YBR_contig GS_tiling Is_predicted_gene Gene_predicted_by Genefinder Vector Is_vector // double appelation fro compatibility Structure From Source UNIQUE ?Sequence XREF Subsequence Subsequence ?Sequence XREF Source UNIQUE Int UNIQUE Int UNIQUE Int UNIQUE Int Section UNIQUE ?Section XREF Sequence Fragment ?Sequence XREF Compound Compound ?Sequence XREF Fragment Int UNIQUE Int UNIQUE Int UNIQUE Int Source_Exons Int COORD UNIQUE Int COORD #Splicing_confirmation // start at 1, to display gene splicing and translations Transcribed_gene ?Transcribed_gene XREF Genomic_sequence UNIQUE Int UNIQUE Int Gene_wall Int UNIQUE Int Super_long SMAP S_Child Genes ?Gene XREF Genomic_sequence UNIQUE Int UNIQUE Int #SMap_info mRNAs ?mRNA XREF Genomic_sequence UNIQUE Int UNIQUE Int #SMap_info RNAi ?RNAi XREF Genomic_sequence Int UNIQUE Int #SMap_info OST ?OST XREF Genomic_sequence Int UNIQUE Int #SMap_info Assembled_in In_mRNA ?mRNA mRNA_tiling ?mRNA Gene Gene_model ?Sequence XREF Model_of Model_of UNIQUE ?Sequence XREF Gene_model Model_of_gene ?Gene XREF Genefinder Model_of_previous_gene ?Gene XREF Previous_genefinder Identifies ?Sequence Version UNIQUE Int Primers Text UNIQUE Text Confirmed_intron Int Int #Splice_confirmation Map ?Map XREF Sequence #Map_position IntMap UNIQUE ?Map UNIQUE Int UNIQUE Int Tested_by Tested_by_AceView Tested_by_JBIRC Tested_by_GBIRC Tested_by_NEDO Tested_by_Kent Tested_by_NCBI Tested_by_NCBH Tested_by_EBI Tested_by_Splign Alibaba ?Transcribed_gene XREF Alibaba cDNA From_gene ?Transcribed_gene XREF Read UNIQUE Int UNIQUE Int UNIQUE Int UNIQUE Int UNIQUE Int UNIQUE Text // length offset lengthmatch nerors quality section From_cosmid ?Sequence Int Int Int Int Int Int Int Int Text // cosmid a1 a2 x1 x2 lengthest ali nerr quality section From_cosmid_jap34_oct13 ?Sequence Int Int Int Int Int Int Int Int Text // cosmid a1 a2 x1 x2 lengthest ali nerr quality section From_cosmid_jap34_oct14 ?Sequence Int Int Int Int Int Int Int Int Text // cosmid a1 a2 x1 x2 lengthest ali nerr quality section From_cosmid_ncbi34_oct14 ?Sequence Int Int Int Int Int Int Int Int Text // cosmid a1 a2 x1 x2 lengthest ali nerr quality section From_cosmid_ncbi34_oct30 ?Sequence Int Int Int Int Int Int Int Int Text // cosmid a1 a2 x1 x2 lengthest ali nerr quality section From_cosmid_jap34_oct30 ?Sequence Int Int Int Int Int Int Int Int Text // cosmid a1 a2 x1 x2 lengthest ali nerr quality section Best_cosmid_alignment ?Sequence Int Int Int Int Int Int Int Int Text// cosmid a1 a2 x1 x2 lengthest ali nerr quality section Best_gene_alignment ?Transcribed_gene Int Int Int Int Int Text// tg len offsett ali nerr quality section Missing_from_gene ?Transcribed_gene XREF Missing_read Assembly Colour #Colour // seen in trace editor Is_Reference // Reference sequence, for acembly: align command Assembled_from ?Sequence XREF Assembled_into UNIQUE Int COORD UNIQUE Int COORD UNIQUE Int UNIQUE Int Assembled_into ?Sequence XREF Assembled_from // these two are the binding relationships reads <-> contigs - they are loose // the first two ints are the positions in the contig. The next two are the left and right clip points // for the read with respect to this assembly. Aligned ?Sequence XREF Aligned_into UNIQUE Int COORD UNIQUE Int COORD UNIQUE Int UNIQUE Int Aligned_into ?Sequence XREF Aligned // for sequence comparisons in acembly // historic of asssemblies History Derived_from UNIQUE ?Sequence UNIQUE DateType Previous_contig ?Sequence XREF Later_part_of UNIQUE Int COORD UNIQUE Int COORD UNIQUE Int UNIQUE Int Later_part_of ?Sequence XREF Previous_contig Golden_path ?Sequence UNIQUE Int COORD UNIQUE Int COORD Phrap Tag // ?Tag_type Int COORD Int COORD Text Template UNIQUE ?Clone XREF Read Align_to_SCF Int COORD UNIQUE Int COORD UNIQUE Int UNIQUE Int // tight alignment of current (edited) read to SCF file Staden_id UNIQUE Int Library ?Library UNIQUE Text UNIQUE Text // Texts are ID, Accession_number // to be used for reads from EMBL etc. Origin From_Library ?Library Dev_stage Text // LOCK Tissue ?Tissue // LOCK Date Text Genetic_Code unique ?Genetic_code @"name" Japanese HINV1 HINV2 Nb_cDNA_clone UNIQUE Int // includes shed clones Species Text Clone_structure Length UNIQUE Int Nb_Exons UNIQUE Int Exon_Length UNIQUE Int Intron_Length UNIQUE Int Gap_Length UNIQUE Int Overlap_right UNIQUE ?Sequence XREF Overlap_left UNIQUE Int // potentially use Overlap_right integer for auto-linking Overlap_left UNIQUE ?Sequence XREF Overlap_right Clone_left_end ?Clone XREF Clone_left_end UNIQUE Int Clone_right_end ?Clone XREF Clone_right_end UNIQUE Int Connected // no gap from here to origin of coordinates Visible Remark ?Text // LOCK what people have put in their GenBank submission Concise_description ?Text // used in wormbase elegans_cds Long_remark ?LongText Function ?Text // LOCK as imported from GenBank Matching_Genomic ?Sequence XREF Matching_cDNA Matching_cDNA ?Sequence XREF Matching_Genomic Matching_transcribed_gene ?Transcribed_gene XREF Matching_genefinder_gene Matching_mRNA ?mRNA XREF Matching_genefinder #Met_stop Matching_product ?Product XREF Matching_gene #Met_stop Identical_to_mRNA ?mRNA XREF Identical_to_genefinder Predicted_mRNA ?mRNA XREF From_prediction Predicted_product ?Product XREF From_prediction Identical_to_product ?Product XREF Identical_to_gene Corresponding_protein UNIQUE ?Protein XREF Corresponding_DNA Related_protein ?Protein XREF Related_DNA Spliced_cDNA ?Sequence XREF Component_of Int UNIQUE Int Int UNIQUE Int Component_of ?Sequence XREF Spliced_cDNA Rescued_gene ?Gene XREF Rescuing_cosmid Locus ?Locus XREF Sequence Locus_62 ?Locus XREF Sequence_62 Locus_81 ?Locus XREF Sequence_81 Locus_84 ?Locus XREF Sequence_84 // 84 o5 85 Locus_89 ?Locus XREF Sequence_89 // Locus_102 ?Locus XREF Sequence_102 // Locus_130 ?Locus XREF Sequence_130 // Locus_GB ?Locus XREF Sequence_GB //LOCK GenBank names like unc-32 Locus_GB_dubious ?Locus XREF Sequence_GB_dubious // GB of bizare form LocusLink ?LocusLink XREF Sequence Locus_cgc ?Locus XREF Sequence_cgc Allele ?Allele XREF Sequence Brief_identification UNIQUE ?Text Expr_pattern ?Expr_pattern XREF Sequence Sage Text Int Int Float // catg #dauer #mixed score Affymetrix Text // used on affymetrix chips NCBI Ref_Seq Provisional_ref_seq Reviewed_ref_seq Predicted_ref_seq LocusLink_ref_seq Validated_ref_seq Inferred_ref_seq Model_ref_seq RefSeqMaker UNIQUE ?mRNA XREF RefSeqMaker Ref_id ?Locus XREF Ref_id NM_id ?GenBank XREF Predicted_gene_NM NM_idexported ?GenBank XREF Predicted_gene_NMexported NM_idaligned ?GenBank XREF Predicted_gene_NMaligned GenBank_id UNIQUE ?GenBank XREF Sequence GeneCard_id UNIQUE Text Ref_mRNA Properties Pseudogene Text Transposon Text // transposon type Coding CDS UNIQUE Int COORD UNIQUE Int COORD CDS_predicted_by ?Method Float // score of method Precursor Covers_product ?Product XREF Covered_by #Coverage Status Received UNIQUE DateType Library_construction UNIQUE DateType Shotgun UNIQUE DateType Shotgun_complete UNIQUE DateType Contiguous UNIQUE DateType Finished UNIQUE DateType Submitted UNIQUE DateType Archived UNIQUE DateType UNIQUE Text // Date Disk ProcessStatus UNIQUE Text Asped UNIQUE DateType Is_mRNA // is_mrna is more specific than it looks.. it // means an mRNA that should be used to construct // a reference sequence (an NM) Is_partial Is_EST Is_mutant Complete_mRNA // same as real_3prime AND Real_5prime Complete_CDS // same has having an SL0, means find Met inside this read Real_5prime // do not fuse upstream by hand Real_3prime // do not fuse downstream by hand Manual_real_5prime // do not fuse upstream by hand Danielle aug23 Manual_real_3prime // do not fuse downstream by hand Danielle aug23 Gold_repeat // repeat identified in Gold project Start_not_found End_not_found GenBank_tag Text Text AM Score UNIQUE Int Rating UNIQUE Text Transcript UNIQUE mRNA UNIQUE Processed_mRNA Unprocessed_mRNA tRNA UNIQUE Text rRNA UNIQUE Text ncRNA UNIQUE Text snRNA UNIQUE Text snoRNA UNIQUE Text scRNA UNIQUE Text stRNA UNIQUE Text // [010723 dl] miRNA UNIQUE Text // [011129 dl] misc_RNA UNIQUE Text Anticodon UNIQUE Text Oligo ?Oligo XREF In_sequence Int UNIQUE Int // for OSP OligoRepeat UNIQUE ?OligoRepeat UNIQUE Int cDNA_clone UNIQUE ?cDNA_clone XREF Read @From_gene cDNA_clone_GB Text EST_translation ?Product XREF From_EST UNIQUE Int UNIQUE Int UNIQUE Int UNIQUE Int // product_from to(excluding stop) .tg (met or leu) atg (met) From_cDNA_clone UNIQUE ?cDNA_clone XREF Read @From_gene Discarded_cDNA ?cDNA_clone XREF Discarded_from Int Int Possible_error_at_base Int UNIQUE Text UNIQUE Text Possible_genomic_error ?Transcribed_gene XREF Possible_genomic_error Int UNIQUE Text Possible_SNP ?Transcribed_gene XREF Possible_SNP Int UNIQUE Text Strand UNIQUE Forward Reverse Intron_boundaries gt_ag UNIQUE Int ct_ac UNIQUE Int gc_ag UNIQUE Int at_ac UNIQUE Int Fuzzy UNIQUE Int other Text UNIQUE Int V_repeat UNIQUE Int // number Exon_coord Int UNIQUE Int Int UNIQUE Int // when mRNA is used as genome: a1 a2 x1 x2 Genbank_CDS UNIQUE Int UNIQUE Int // start stop of cds as seen in genbank Bad_quality Text Directed_sequencing Opposite ?Sequence XREF Opposite Clone ?Clone Subclone UNIQUE ?Clone XREF Read @Read Duplicate_of_read ?Sequence // do not XREF Duplicate_of_read, do not label smallest Insert_size UNIQUE Int UNIQUE Int // should really be in subclone Seq_vec ?Vector Int Int Text Clone_vec ?Vector Int Int Text aPrioriStrand UNIQUE aForward aReverse manualStrand UNIQUE mForward mReverse RNA_editing Int ?Transcribed_gene Int PolyA_after_base UNIQUE Int COORD manual_polyA UNIQUE Int COORD Number_of_N UNIQUE Int UNIQUE Int Number_of_terminal_A UNIQUE Int Initial_polyA UNIQUE Int COORD UNIQUE Int // start position number of A Initial_polyT UNIQUE Int COORD UNIQUE Int // start position number of T Transpliced_to ?Motif UNIQUE Int UNIQUE Text Transpliced_to2 ?Motif UNIQUE Int UNIQUE Text Transpliced_to3 ?Motif UNIQUE Int UNIQUE Text Manual_transpliced_to ?Motif UNIQUE Int UNIQUE Text Dye UNIQUE Dye_Primer Dye_Terminator Primer_Info UNIQUE Universal_primer Custom UNIQUE Text // text may be the oligo - or should it be an object? Primer UNIQUE ?Primer XREF Read Contains Multiplet ?Clone XREF Contig UNIQUE Int // Dog mapping of contigs // Clips is a tag 2 system, any sequence editor should update all numbers at once on a deletion Clips Clipping UNIQUE Int COORD UNIQUE Int COORD // present clipping Old_Clipping UNIQUE Int COORD UNIQUE Int COORD // as imported from Ted CAF_Clipping UNIQUE Int COORD UNIQUE Int COORD // as imported from CAF Vector_Clipping UNIQUE Int COORD UNIQUE Int COORD UNIQUE ?Vector Text// vector clipping, do not overpass, Text = OPen, meaning the est has its ORF open above the vector clipping Contamination Int UNIQUE Int ?Vector // do not use to seed Hand_Clipping UNIQUE Int COORD UNIQUE Int COORD // hand clip, can be restored Excellent_upto UNIQUE Int COORD Good_upto UNIQUE Int COORD Fair_upto UNIQUE Int COORD Best200 UNIQUE Int Discarded By_hand ABI ABI_Date Text Run_Start Text Run_Stop Text BaseCall ?BaseCall UNIQUE Int OriginalBaseCall ?BaseCall SCF_Position ?BasePosition UNIQUE Int // CALF system Quality ?BaseQuality UNIQUE Int // Int between 0 (bad) and 50 (excellent) Base_caller Text // Phred, ABI, acembly Significant_bases Int COORD UNIQUE Text Otto Text REPEAT Stolen ?Clone ABI_Comment Text // comments no s for compatibility, ABI_Comments Text // comments with s, using Text rather than expansive ?Text ABI_Analysis Text ABI_Machine Text Sample Text SCF_File UNIQUE Text CTF_File UNIQUE Text // for acembly: absolute file name, or relative to $SCF_DATA, or to $ACEDB/SCF New_Read // Set by newScf, used by add new reads Fragment_of UNIQUE ?Sequence Padding UNIQUE Padded Unpadded DB_info Database ?Database Text Text Text // ID Accession.Version GI AC_number Text NI_number UNIQUE Text Protein_id Text UNIQUE Int DB_remark ?Text // EMBL/GenBank SwissProt_DE ?Text // Swiss prot description Keyword ?Keyword // // LOCK EMBL/GenBank DB_annotation ?Database UNIQUE ?LongText EMBL_dump_info #EMBL_dump_info Imported DateType Text Text // The date is the date that this sequence object // was imported from some external database. // The first text is the name of the importing // program. The second text is the query // identifier that the import program used to // obtain the data. Not_curated Transfered // This tag is set by the importing program // to indicate that this record has not been // examined and/or edited by a biologist. It is // cleared when the record is manually curated. Similarity Homol DNA_homol ?Sequence XREF DNA_homol ?Method Float Int COORD UNIQUE Int COORD Int UNIQUE Int #Homol_info Pep_homol ?Protein XREF DNA_homol ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Motif_homol ?Motif XREF DNA_homol ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Sage_hit ?Sage XREF Hits ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Primer_hit ?Primer XREF Hits ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Pfam_homol ?Pfam XREF CDS ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Cel_homol ?Pfam XREF CDS ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Vector_homol ?Pfam XREF CDS ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info No_homol ?Pfam XREF CDS ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Other_homol ?Pfam XREF CDS ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info // We will generate a column for each distinct ?Method. So for // distinct Worm_EST and Worm_genomic columns, use ?Method objects // Worm_EST_Blastn and Worm_genomic_Blastn. Hit ?Sequence XREF Hit Int COORD UNIQUE Int COORD Int COORD UNIQUE Int COORD BlastHit ?Sequence XREF BlastHit Int COORD UNIQUE Int COORD Int COORD UNIQUE Int COORD WordHit ?Sequence XREF WordHit UNIQUE Int KentHit ?Sequence XREF KentHit Int COORD UNIQUE Int COORD Method UNIQUE ?Method Feature ?Method Int Int UNIQUE Float UNIQUE Text // Float is score, Text is note // note is shown on select, and same notes are neighbours // again, each method has a column double-click shows the method. // Absorb Assembly_tags? #Coverage Gap Gap_length UNIQUE Int nX UNIQUE Int Length From Int To Int CDS_length UNIQUE Int Text // Length of corresponding CDS in Read Delta UNIQUE Int Text // positive if Read CDS longer than Product CDS Variation Nv UNIQUE Int Text // number of AA differences in Product zone, when delta >= 0 Score UNIQUE Float // use Blosom to measure the AA imporatance Type UNIQUE Text // P236V V2423P (P236 exists and is AA 236 of Product) #Splice_confirmation cDNA EST Homology Spliced_cDNA Begin_Not_Found End_Not_Found #Met_stop Predicted_Met UNIQUE mExact mInexact mNoInfo mAbsent Predicted_Stop UNIQUE sExact sInexact sNoInfo sAbsent Includes Included Identical Different Same_5p Shorter_5p Longer_5p Identical_internal_exon UNIQUE Int Different_internal_exon UNIQUE Int Same_3p Shorter_3p Longer_3p #Protein_fragment Exon UNIQUE Int UNIQUE Text // 23 56 aa UTR_3prime UTR_5prime Gap ORF_Gap #Splicing_confirmation Intron UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // gt_ag, Length, %d , bp Exon UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // exon number, length,%d, bp Partial_Exon UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // exon number , length,, bp First_Exon UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // exon number , length,, bp Last_Exon UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // exon number , length,, bp Stolen_Exon UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // exon number , length,, bp Predicted_Exon UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // exon number , length,, bp Gap UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // 'unspanned' length,, bp ORF_Gap UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // 'open'exon number, length,, bp Alternative_Intron UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // frame, gt_ag, Length,, bp Stolen_Intron UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // frame, gt_ag, Length,, bp Predicted_Intron UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // frame, gt_ag, Length,, bp Alternative_Exon UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // exon number , length,, bp Alternative_First_Exon UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // exon number , length,, bp Alternative_Partial_Exon UNIQUE Text UNIQUE Text UNIQUE Int UNIQUE Text // exon number , length,, bp 3prime_UTR 5prime_UTR UTR_3prime UTR_5prime ?Protein Title UNIQUE ?Text Other_name ?Text // for repeats Description ?Text Reference Text Locus ?Locus XREF Protein Peptide UNIQUE ?Peptide UNIQUE Int UNIQUE Int // Length + checksum View ?View Default_view UNIQUE ?View DB_info Database ?Database Text Text // ID Accession_number DB_remark ?Text // Swissprot CC entries Keyword ?Keyword // Swissprot DB_searched ?Database Text // Version Origin From_Database ?Database UNIQUE Int // release number Date DateType Text // Text for comments on operation Species ?Species Wormpep Replaces ?Protein XREF Replaced_by Inactive Replaced_by ?Protein XREF Replaces // inactive wormpep entries won't be output in standard wormpep dumps Visible Corresponding_DNA ?Sequence XREF Corresponding_protein Related_DNA ?Sequence XREF Related_protein Related_protein ?Protein XREF Related_protein // tag2 system. For now I have not populated this column. For C. elegans // wormpep we want to get the information from the ?Corresponding_DNA // object. Because those objects have long term continuity, while wormpep // objects are one per protein sequence. At least that is the current // plan. Swiss_feature Text Int Int Text // feature name, start, stop, note Match_table UNIQUE ?MatchTable Homol DNA_homol ?Sequence XREF Pep_homol ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Pep_homol ?Protein XREF Pep_homol ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Motif_homol ?Motif XREF Pep_homol ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Product_homol ?Product XREF Blastp ?Method Float Int UNIQUE Int Int UNIQUE Int #Homol_info Feature ?Method Int Int UNIQUE Float // display according to method // double-click shows the method #Match Percent_identity UNIQUE Int Score ?Method UNIQUE Float N_gaps UNIQUE Int Loop UNIQUE Int UNIQUE Int // rel start, stop Unit_Length UNIQUE Int // Method ?Method Remark ?Text // the Display information controls how the column looks. Display No_display Colour #Colour CDS_colour #Colour Frame_sensitive Strand_sensitive Show_up_strand #Colour Score Score_by_offset // has priority over width, for Jean Score_by_width Score_by_histogram UNIQUE Float // baseline value Score_bounds UNIQUE Float UNIQUE Float // limits for squashing Percent // '%' in text, + default bounds 25, 100 Overlap_mode UNIQUE Overlap // draw on top - default Bumpable // bump to avoid overlap Cluster // one column per homol target Width UNIQUE Float Symbol UNIQUE Text // first char only is used Right_priority UNIQUE Float // the greater the more right Web_right_priority UNIQUE Float // superseded web_priority on the web Max_mag UNIQUE Float // don't show if more bases per line Min_mag UNIQUE Float // don't show if fewer bases per line Show_text // only put text in right-hand column if set Blastn // can calculate percent from score if blastn Blixem Blixem_X Blixem_N Blixem_P Belvu Gene_assemble Gene_assemble_method ?Method UNIQUE Float // Float factor to multiply score by Intron_min UNIQUE Int Exon_min UNIQUE Int Intron_cost UNIQUE Float UNIQUE Float UNIQUE Int // base cost, cost per log bp beyond min // Int is min for this if not Intron_min Inter_gene_cost UNIQUE Float GF_parameters GF_range UNIQUE Int // +- range for genefinder feature calculation GF_ATG_cutoff UNIQUE Float GF_5_cutoff UNIQUE Float GF_3_cutoff UNIQUE Float EMBL_dump_info #EMBL_dump_info EMBL_dump EMBL_feature UNIQUE Text // require this EMBL_threshold UNIQUE Float // apply to score unless overridden EMBL_qualifier Text UNIQUE Text GFF GFF_source UNIQUE Text GFF_feature UNIQUE Text // if 1 Text, it is the entire qualifier including '/' // if 2 Texts, 1st is an sprintf format and 2nd is // an argument. If this is "score", "note", "y1", "y2" or "target" // then use the corresponding field of the Feature or Homol line. // multiple formats will be concatenated until one starts with '/'. #EMBL_dump_info EMBL_dump_method UNIQUE ?Method ID_template UNIQUE Text ID_division UNIQUE Text DE_format UNIQUE Text OS_line UNIQUE Text OC_line Text RL_submission Text // EMBL_reference ?Paper CC_line Text source_organism UNIQUE Text #Homol_info Segs #Match_seg Bury // do not show on the standard display Score UNIQUE Float // remember the score and the expect are both mysterious but different Expect UNIQUE Float // remember the score and the expect are both mysterious but different Confidence Text // exemple in pfam a !! means we believe it ! #Match_seg UNIQUE Int UNIQUE Int UNIQUE Int UNIQUE Int #Match_seg // Start, End of Aligment; Start, End of Subject ?Locus Map ?Map XREF Locus #Map_position Gene ?Gene XREF Locus Gene_class ?Gene_class XREF Loci OMIM ?OMIM XREF Locus LocusLink ?LocusLink XREF Locus GeneId ?GeneId XREF Locus Gene_information ?Text Sequence ?Sequence XREF Locus Sequence_62 ?Sequence XREF Locus_62 Sequence_81 ?Sequence XREF Locus_81 Sequence_84 ?Sequence XREF Locus_84 Sequence_89 ?Sequence XREF Locus_89 Sequence_102 ?Sequence XREF Locus_102 Sequence_130 ?Sequence XREF Locus_130 Sequence_GB ?Sequence XREF Locus_GB Sequence_GB_dubious ?Sequence XREF Locus_GB_dubious Sequence_cgc ?Sequence XREF Locus_cgc SequenceTmp ?Sequence Protein ?Protein XREF Locus Transcribed_gene ?Transcribed_gene XREF Locus Ref_id ?Sequence XREF Ref_id Priority UNIQUE Int // for hierarchical display Quality UNIQUE Int // for hierarchical display Expr_pattern ?Expr_pattern XREF Locus Reference ?Paper XREF Locus ?OMIM Gene ?Gene XREF OMIM Locus ?Locus XREF OMIM GeneId ?GeneId XREF OMIM Sequence ?Sequence XREF OMIM Description ?Locus_description XREF OMIM // // Views and Columns // ?View Type UNIQUE Pepmap Fmap Fmap_Header Fmap_Locator Fmap_Summary_bar Fmap_scale Fmap_scale_coords Fmap_DNA Fmap_3_translation Fmap_Clones Fmap_Gene Fmap_Gene_Name Fmap_Cloud_gene Fmap_Gene_Up Fmap_Gene_Down Fmap_Pg Fmap_Pg_Up Fmap_Pg_Down Fmap_Tg Fmap_Tg_Up Fmap_Tg__Down Fmap_Tg_Just_Gold Fmap_mRNA Fmap_mRNA_Up Fmap_mRNA_Down Fmap_mProduct Fmap_Down_Gene_Translation Fmap_Spliced_cDNA Fmap_CDS_Tiling Fmap_cDNA_Decorate Fmap_Spliced_cDNA_Up Fmap_Spliced_cDNA_Down Fmap_RNAi Fmap_RNAi_Up Fmap_RNAi_Down Fmap_Oligo Fmap_Allele Fmap_Text_Features Gmap Grid Grid_map Int #View_tags // Int is priority Grid_edit_default UNIQUE Text UNIQUE Text Grid_edit_menu Text UNIQUE Text Pmap Pmap_probes Pmap_probe_query Text Pmap_probe_height Int Pmap_YAC Pmap_YAC_query Text Pmap_YAC_bold_query Text Pmap_YAC_height Int Pmap_cmid Pmap_cmid_query Text Pmap_cmid_bold_query Text Pmap_cmid_height Int Pmap_locus Pmap_locus_query Text Pmap_locus_height Int Pmap_remark Pmap_remark_query Text Pmap_remark_height Int // 1st text tag name, 2nd text optional "Negative" Display Submenus // BOOL for submenus on item boxes Cambridge // Cambridge v. Montpellier behaviour No_buttons // suppress header buttons for WWW Hide_header // No headers and footers Name UNIQUE Text Columns Text UNIQUE Int #Column // Int is BOOL for Hidden/Visible ?Column UNIQUE Scale Scale_unit UNIQUE Float // minimum increment Cursor Cursor_on Cursor_unit UNIQUE Float Scroller Locator Magnification UNIQUE Float Projection_lines_on Marker_points Marker_intervals Contigs Reversed_physical Physical_genes Two_point Multi_point Likelihood Points Point_query UNIQUE Text Point_yellow Text // To be made redundant. Point_colour Text #Colour // to replace above Point_width UNIQUE Int // max width if not at RHS Point_error_scale UNIQUE Float Point_segregate_ordered Point_show_marginal Point_pne #Colour // positive, no error Point_pe #Colour // positive, error Point_nne #Colour // negative, no error Point_ne #Colour // negative, error Point_symbol Text // can now have more than one of these Interval_JTM #Interval_col_conf Interval_RD #Interval_col_conf Interval_SRK #Interval_col_conf Derived_tags DT_query UNIQUE Text DT_width UNIQUE Int DT_no_duplicates DT_neighbours DT_parents DT_follow_parent DT_symbol_query DT_tag Text Int DT_hide Spacer Spacer_colour #Colour Spacer_width Float RH_data RH_query UNIQUE Text RH_spacing UNIQUE Float RH_show_all RH_positive #Colour RH_negative #Colour RH_contradictory #Colour pepSequence PS_Highlight_residue // il all needed for colomn display of peptides PS_Residues_per_wrap Int PS_Colours Text #Colour Hydrophobicity HP_Show_Zero_bar HP_Fixed_Scaling HP_Calculation_window Int HP_Display_width Int Homol HOM_bump pepFeature FEA_bump FEA_Query Text Homol_Name HOM_NAME_bump HOM_NAME_width Int pepActiveZone Submaps Loci_Query UNIQUE Text Interval_Query UNIQUE Text Show UNIQUE Int Tolerance UNIQUE Int Pos_By_Loci ?View_tags Colour #Colour Surround_colour #Colour // colour when surround Tag Text // could be many tags ?Interval_col_conf Query UNIQUE Text // Query Names_on No_neighbours Show_multiple Width UNIQUE Int Symbol UNIQUE Text Colours Text #Colour // Only for chrom_bands. Pne #Colour // positive, no error Pe #Colour // positive, error Nne #Colour // negative, no error Ne #Colour // negative, error ?Url Url UNIQUE Text // Simple, text of Url Template UNIQUE ?Url // use this object as a generic template Reference_tag UNIQUE Text // look for this tag in the reffing object for url Remove_prefix UNIQUE Text // prefix to remove to make url Remove_postfix UNIQUE Text // postfix to remove Prepend UNIQUE Text // then add these. Append UNIQUE Text Use_name Refers_to cDNA_clone ?cDNA_clone XREF Image ?Library Title UNIQUE ?Text Symbol UNIQUE Text // One letter symbol, to be displayed under the Read arrow Vector_length UNIQUE Int // (bp) length clone - length insert Expression_profile Int REPEAT Stage UNIQUE Mixed Embryo L1 L2 L3 Dauer L4 Ovary ?Database Title UNIQUE ?Text ?Species Title UNIQUE ?Text ?Sage Origin Text Motif UNIQUE Text Length UNIQUE Int Strand UNIQUE Forward Reverse RNAi ?RNAi XREF Primer Hits ?Sequence XREF Sage_hit Int UNIQUE Int ?Fiche mRNA ?mRNA XREF Fiche FichedDate UNIQUE Text SubmittedDate UNIQUE Text Title UNIQUE Text FlatFile UNIQUE Text Blast UNIQUE Text Hints UNIQUE Text Status UNIQUE Text #SMap_info Method ?Method // methods used in child (optional) Frame UNIQUE Int Content Homol_only // useful for -nohomol gff option Feature_only // useful for -nofeature gff option Mapping Align Int UNIQUE Int UNIQUE Int // not needed if full alignment is ungapped // one row per ungapped alignment section // first int is position in parent, second in child // third int is length - only necessary when gaps in both sequences align Mismatch Int // Int give position(s) in parent of mismatches (technically in which they will // not create an error if they occur // if just the tag is set without values, then accept mismatches anywhere Display Max_mag UNIQUE Float // don't show if more bases per line Min_mag UNIQUE Float // don't show if fewer bases per line // locus->Molecular_information->Product->Text should go in the title bar of the TGin some way // the name of the phenotype is either unc-32 or 3B231 or zk637.4 if no info if associated with sjj-pair ?Chrom_band Gene ?Gene XREF Cytogenetic ?Unigene Gene ?Gene XREF Unigene GeneId ?GeneId XREF Unigene ?LocusLink Gene ?Gene XREF LocusLink // MUST be top line to simplify transfer of data Title UNIQUE Text // human extracted from locus id Summary UNIQUE Text // human extracted from locus id Proteome_summary UNIQUE Text // human extracted from locus id GeneId ?GeneId XREF LocusLink Locus ?Locus XREF LocusLink Genetic Locus_Phenotype ?Text // Locus->phenotype but only [C.elegansII] if existing Locus_description ?Text Gene_RIF Text // goes to Gene->Locus_Phenotype OMIM ?OMIM Go_b_ace ?GO_b Text Text Molecular Descriptor ?Text // wormbase:locus->geneclass->phenotype //human: refseq +proteomesummary Properties Text Go_m_ace ?GO_m Text Text Function EC_number ?Text Gene_ontology Text Text Text Text Expression Go_c_ace ?GO_c Text Text Sequence ?Sequence XREF LocusLink Reference Text //?Paper XREF Gene // locus->reference Position Map Text Cytogenetic Text Text ?Allele Gene ?Gene XREF Allele Strain ?Strain XREF Allele Sequence ?Sequence XREF Allele Remark ?Text ?Knock_out Gene ?Gene XREF Knock_out Locus ?Locus Cosmid UNIQUE ?Sequence UNIQUE Int UNIQUE Int // position according to ko consortium Predicted_gene ?Sequence Strain ?Strain Description UNIQUE Text ?Locus_description Symbol Text // 3 letter symbol Gene ?Gene XREF Locus_description Gene_descriptor ?Gene XREF Descriptor Genbank_product_descriptor ?Gene XREF Genbank_product_descriptor Gene_class ?Gene_class XREF Description OMIM ?OMIM XREF Description ?GenBank Gene_id ?Gene XREF GenBank_id GeneId ?GeneId XREF NM_id Gene_NM ?Gene XREF NM_id NewName ?NewName XREF NM_id Predicted_gene_NM ?Sequence XREF NM_id Predicted_gene_NMexported ?Sequence XREF NM_idexported Predicted_gene_NMaligned ?Sequence XREF NM_idaligned mRNA ?mRNA XREF NM_id mRNAexported ?mRNA XREF NM_idexported mRNAaligned ?mRNA XREF NM_idaligned GB_clone ?cDNA_clone XREF NM_id Sequence ?Sequence XREF GenBank_id Variant Text NPtext Text // corresponding NP Supporting_GB ?Sequence Info Submission_date DateType Title UNIQUE ?Text // hand edited at submission time Product Product_Title UNIQUE ?Text // hand edited at submission time mRNA_signature UNIQUE Int // establishes the signature of this submission Fiche UNIQUE ?LongText // fiche as hand edited at submission time Author ?Author REPEAT Status UNIQUE RefSeq UNIQUE Predicted_refseq Provisional_refseq Validated_refseq Inferred_ref_seq LocusLink_refseq Reviewed_refseq Secondary_refseq Supported UNIQUE mRNA_evidence EST_evidence mRNA_EST_evidence Ab_initio with_EST_support ?Gene_id Gene ?Gene XREF Gene_id ?Gene_title Gene ?Gene XREF Title ?Gene Title UNIQUE ?Gene_title XREF Gene // hand edited Title2 UNIQUE ?Text // hand edited tmp for debug Summary ?Text // hand edited, rm UNIQUE jan 23, 2004 Proteome_summary UNIQUE ?Text // hand edited Transcribed_gene ?Transcribed_gene XREF Gene @T Product ?Product XREF GeneBox @ID // pfam_go a mettre sous ID NewName UNIQUE ?NewName XREF Gene UNIQUE Text // NCBI Text = locuslink|pfam|pseudo|doublelocuslink newName NewNameOld ?NewName XREF GeneOld UNIQUE Text // NCBI Text = locuslink|pfam|pseudo|doublelocuslink newName Tmp Text // for temporary use such as while exporting to locuslink WB_id ?Text // ->mocecular, avant old_product, herited from wormbase-51, then hand edited WbId ?WbId XREF Gene GenBank_id ?GenBank XREF Gene_id @Info // NCBI // GenBank submission, to be revamped NM_id ?GenBank XREF Gene_NM Text // NCBI Gene_id UNIQUE ?Gene_id XREF Gene // NCBI GeneId ?GeneId XREF Gene // NCBI LocusLink ?LocusLink XREF Gene // NCBI locuslink GeneCard_id UNIQUE Text // GeneCard Unigene ?Unigene XREF Gene Clone_group ?Clone_group XREF Gene UNIQUE Int // NCBI //To be fixed in code, number of clones of that group Error_in_genome Bad_quality Use_AM // use_am ->NCBI==ID, Error, to keep, detail de la soumission de l'error Notes ?Text Specialist ?Person XREF Specialist Text Type Main Putative Cloud Molecular Descriptor ?Locus_description XREF Gene_descriptor // wormbase:locus->geneclass->phenotype Genbank_product_descriptor ?Locus_description XREF Genbank_product_descriptor EC_number ?Text // a completer, now just let-70 Properties ?Text Cloud_gene Pseudogene // COUNT {>transcribed_gene;!gt_ag && !gc_ag;>mrna;COUNT cdna_clone>3 && tiling_error>10}>0 Non_protein_coding // non protein coding gene COG ?COG XREF Gene @Info GO_m_pfam ?GO_m XREF Gene Text // Text is the method IEAA etc GO_m_ace ?GO_m XREF Genea Text Text // Text is the method IEAA etc Gene_ontology Pfam_go Text Text Text // DELETE, in product, oxydase IP2001 GO:1234 Pfam ?Pfam XREF Gene Old_product ?Text // 112 cases DELETE ?? Predicted Genefinder ?Sequence XREF Model_of_gene Previous_genefinder ?Sequence XREF Model_of_previous_gene // tmp when moving Homolog In_human Text // Text, because this is an external reference In_Arabidopsis Text // Text, because this is an external reference In_drosophila Text // Text, because this is an external reference In_worm Text // Text, because this is an external reference Genetic Locus ?Locus XREF Gene // all ?Locus of wormbase with Phenotype OR Allele Locus_description ?Locus_description XREF Gene // locus->description, some locus->geneclass->phenotype Locus_Phenotype ?Text // copy here LocusLink->Loc_pheno or in worm [C.elegansII] if existing Gene_RIF ?Text // goes to Gene->Locus_Phenotype GO_b_pfam ?GO_b XREF Gene Text // Text is the method IEAA etc GO_b_ace ?GO_b XREF Genea Text Text // Text is the method IEAA etc GO_locuslink Text Text Text// to import from locusLink in human case OMIM ?OMIM XREF Gene @Description // human only // Locus_remark ?Text // Locus->remark to verify Allele ?Allele XREF Gene Knock_out ?Knock_out XREF Gene Knock_out_allele Text Text Text Text Strain ?Strain XREF Gene @Remark // A reimporter en diff versus WS51 Rescued_by ?Text // 11 DELETE ? Not_rescued_by Text // if !SMAP, 63 cases ??? Rescuing_cosmid ?Sequence XREF Rescued_gene Text REPEAT // if !SMAP, 1158 cases RNAi ?RNAi XREF Gene @P // move away the OST from here Transgenic ?Text // 86 cases Expression Expression_title UNIQUE ?Text Expression_profile @">Transcribed_gene ; Expression_profile" Has_expression_profile UNIQUE Int REPEAT // a copy for the exported database Pattern ?Text // hand curated resume of all expr_patterns GO_c_psort ?GO_c XREF Geneps Text // Text is the method IEAA etc GO_c_pfam ?GO_c XREF Gene Text // Text is the method IEAA etc GO_c_ace ?GO_c XREF Genea Text Text// Text is the method IEAA etc Expr_pattern ?Expr_pattern XREF Gene Has_OST // == has amplified non ambiguous OST OST ?OST XREF Gene Has_cDNA_clone ?cDNA_clone XREF In_gene Nb_cDNA_clone UNIQUE Int // includes shed clones Regulation Promoter ?Text Complex_locus Operon Operon_title ?Text Operon_with ?Gene XREF Operon_with SL2_Blumenthal SL2_Kohara Other_tandem ?Text Antisense ?Text Antisens_to ?Gene XREF Antisens_to UNIQUE Int Shedded_from ?Gene XREF Sheds Sheds ?Gene XREF Shedded_from Highly_mutable ?Text RNA_editing ?Text Translational_frameshift ?Text Selenocysteine ?Text Interacts with_gene ?Gene XREF with_gene ?Text // 150 cases with_geneId ?GeneId XREF with_geneBox ?Text // 150 cases with_protein ?Gene XREF with_protein ?Text // 50 cases Reference ?Paper XREF Gene // locus->reference WB_reference ?Paper XREF Gene_wb GenBank_reference ?Paper XREF Gene_gb DbXref Text UNIQUE Text Method ?Method // a vider Structure nExons UNIQUE Int nIntrons UNIQUE Int First_exon nPossiblePromotors UNIQUE Int nAltFirstExons UNIQUE Int nNonOverlappingAltFirstExons UNIQUE Int nAltFirstCodingExons UNIQUE Int Central_exon n5pSkippedCentralExons UNIQUE Int nSkippedCentralExons UNIQUE Int nsce nAnyCassettedExons UNIQUE Int nCassettedExons UNIQUE Int nCassettingIntrons UNIQUE Int nMultiCassettedExons UNIQUE Int nMultiCassettingIntrons UNIQUE Int nMutExclusives UNIQUE Int nCitroenIntrons UNIQUE Int nOverlappingCentralExons UNIQUE Int noce nInternalDonorSite UNIQUE Int nInternalDonorSite369_18 UNIQUE Int REPEAT nInternalAcceptorSite UNIQUE Int nInternalAcceptorSite369_18 UNIQUE Int REPEAT nRetainedIntrons UNIQUE Int nOrfBreakingRetainedIntrons UNIQUE Int // break the ORF Last_exon n3pSkippedCentralExons UNIQUE Int nAltLastExons UNIQUE Int nNonOverlappingAltLastExons UNIQUE Int Position Balise // balise genes are shown to allow rapid motion on the maps Map ?Map XREF Gene #Map_position Map_priority UNIQUE Int InterpolatedMap UNIQUE ?Map UNIQUE Float IntMap UNIQUE ?Map XREF Gene_i UNIQUE Int UNIQUE Int Cytogenetic ?Chrom_band XREF Gene Text // human SMAP S_Parent Genomic_sequence UNIQUE ?Sequence XREF Genes Primers ?Primer XREF Gene // Tracking, used when changing genome release Ambiguous // Tracking, when positioned by primers used when changing genome release Same_position // Tracking, used when changing genome release Previous_cosmid UNIQUE ?Sequence UNIQUE Int UNIQUE Int // Tracking, used when changing genome release ?RNAi Gene ?Gene XREF RNAi mRNA ?mRNA XREF RNAi #Met_stop Experiment Reference Text // Paper as in medline Author Text // ?Author Date UNIQUE DateType Injection Feeding Probe cDNA_clone ?cDNA_clone XREF RNAi PCR_product Primer ?Sage XREF RNAi // ?PCR_product->Oligo Primers ?Primer XREF RNAi // ?PCR_product->Oligo Ambiguous P Phenotype ?Text // ?RNAi ->Phenotype && ?RNAi->Phenotype->description %% ?Rnai ->Phenotype##Phenotype_info Movie ?URL Hyman DIC_Phenotype_Class ?Text DIC_Phenotype_Definition ?Text DIC_Phenotype_Description ?Text DIC_Movie_available Progeny_Phenotype_Class ?Text Progeny_Phenotype_Definition ?Text Progeny_Phenotype_Description ?Text No_obvious_phenotype Text Position IntMap UNIQUE ?Map Int UNIQUE Int SMAP S_Parent Genomic_sequence ?Sequence XREF RNAi Remark ?Text Predicted_gene ?Sequence ?OST Gene ?Gene XREF OST T Target UNIQUE Text // target accoding to vidal Target_found // AceView analysis R Amplified // experimental result Not_amplified // experimental result C Complete // exactly agrees with Tg Partial // matches but too short relaive to Tg Bad // not expected to amplify Primers ?Primer XREF OST P Amplified_not_ambiguous // result + alignment summary Ambiguous // alignment summary Position IntMap UNIQUE ?Map Int UNIQUE Int SMAP S_Parent Genomic_sequence ?Sequence XREF OST ?Strain Genotype Text Contains Gene ?Gene XREF Strain Allele ?Allele XREF Strain Expr_pattern ?Expr_pattern XREF Strain Remark ?Text ?Expr_pattern Gene ?Gene XREF Expr_pattern Locus ?Locus XREF Expr_pattern Sequence ?Sequence XREF Expr_pattern Protein_description Text // dl1 010307 from geneace Expressed_in Cell ?Text Cell_group ?Text Life_stage Text Subcellular_localization ?Text Type Reporter_gene Text In_situ Text Antibody Text Transgene Text Western Northern RT_PCR Text Pattern ?Text Remark Text Experiment Laboratory ?Laboratory Author Text Date UNIQUE DateType Strain UNIQUE ?Strain XREF Expr_pattern Picture Reference ?Paper XREF Expr_pattern Not_done ?Medline Paper ?Paper XREF Medline_acc Paper_PMID ?Paper XREF PMID Paper_CGCID ?Paper XREF CGCID Paper_LeonID ?Paper XREF LeonID ?Journal Full_name ?Text Paper ?Paper ?GO Nickname UNIQUE Text Type Molecular_function ?GO_m XREF GO Biological_process ?GO_b XREF GO Cellular_component ?GO_c XREF GO Synonym ?GO_s XREF GO Pfam ?Pfam XREF GO ?GO_b GO ?GO XREF Biological_process Gene ?Gene XREF GO_b_pfam Genea ?Gene XREF GO_b_ace ?GO_c GO ?GO XREF Cellular_component Geneps ?Gene XREF GO_c_psort Gene ?Gene XREF GO_c_pfam Genea ?Gene XREF GO_c_ace ?GO_m GO ?GO XREF Molecular_function Gene ?Gene XREF GO_m_pfam Genea ?Gene XREF GO_m_ace ?GO_s GO ?GO XREF Synonym ?COG Info Title ?Text Information_storage_and_processing Translation_ribosomal_structure_and_biogenesis J ?Text Transcription K ?Text DNA_replication_recombination_and_repair L ?Text Cellular_processes Cell_division_and_chromosome_partitioning D ?Text Posttranslational_modification_protein_turnover_chaperones O ?Text Cell_envelope_biogenesis_outer_membrane M ?Text Cell_motility_and_secretion N ?Text Inorganic_ion_transport_and_metabolism P ?Text Signal_transduction_mechanisms T ?Text Metabolism Energy_production_and_conversion C ?Text Carbohydrate_transport_and_metabolism G ?Text Amino_acid_transport_and_metabolism E ?Text Nucleotide_transport_and_metabolism F ?Text Coenzyme_metabolism H ?Text Lipid_metabolism I ?Text Secondary_metabolites_biosynthesis_transport_and_catabolism Q ?Text Poorly_characterized General_function_prediction_only R ?Text Function_unknown S ?Text Gene ?Gene XREF COG Sequence ?Sequence XREF COG ?Genetic_code Other_name ?Text NCBI_id UNIQUE Int Translation UNIQUE Text Start UNIQUE Text Base1 UNIQUE Text Base2 UNIQUE Text Base3 UNIQUE Text ?Paper Title ?Text Author Text // ?Author // XREF Paper Journal UNIQUE ?Journal Year UNIQUE Int Volume Text Text Page UNIQUE Text UNIQUE Text Medline_acc UNIQUE ?Medline XREF Paper PMID UNIQUE Text // ?Medline XREF Paper_PMID CGCID UNIQUE ?Medline XREF Paper_CGCID LeonID UNIQUE ?Medline XREF Paper_LeonID Sequence ?Sequence // XREF Reference Gene ?Gene XREF Reference Gene_class ?Gene_class XREF Reference Locus ?Locus XREF Reference Gene_symbol Text // ?Text GeneId ?GeneId XREF Reference EC_symbol Text Pfam ?Pfam XREF Paper Erratum_in Text Retraction_in Text Citation Text Gene_wb ?Gene XREF WB_reference Gene_gb ?Gene XREF GenBank_reference Gene_mark ?Gene Expr_pattern ?Expr_pattern XREF Reference Not_done Abstract ?LongText //----------------------------------------------------------------------------- // Paper is a description of a paper. Author is a reference to all the // authors of the paper, but see author below. ?Author Full_name ?Text Person ?Person XREF Author Paper ?Paper // do NOT XREF, this would alter the author order //----------------------------------------------------------------------------- // Author is really just a name that is signed to a paper. It has a // reference back to all the papers it was signed to, but we don't really // know who it is. For example, Medline might list both John Smith and // James Smith as "Smith J". We would then have an author named "Smith J" // with the Who tag referencing both of them. A human reading the displayed // data would be able to deal with the ambiguity even if a computer cannot. //----------------------------------------------------------------------------- ?Laboratory Address Mail Text Phone Text E_mail Text Fax Text CGC Representative UNIQUE ?Person XREF Laboratory Strain_designation Text Allele_designation Text Gene_classes ?Gene_class XREF Designating_laboratory //----------------------------------------------------------------------------- // Laboratory describes an institution. The Address tag refers to the // organization, not a person at that organization. In particular, E_mail // should be a general purpose address like "info" instead of the email // address of the director. // Contact is a person who expects to handle laboratory business. // Who is a list of persons affiliated with that laboratory. // //----------------------------------------------------------------------------- ?Person Full_name ?Text UNIQUE Text UNIQUE Text UNIQUE Text // for gb submission: full, surname, first, initial Author ?Author XREF Person @Paper Address Mail Text E_mail Text Phone Text Fax Text Laboratory UNIQUE ?Laboratory XREF Representative Gene_class ?Gene_class XREF Specialist Specialist ?Gene XREF Specialist Notes ?Text //----------------------------------------------------------------------------- // Person describes a real person. // Names is a list of names that we know this person by. // Author is a list of names that they have used to publish papers. // // For example, "Robert Smith" might have // // Names // "Robert Smith" // "Bob Smith" // "Robert W Smith" // Author // "Smith R" // "Smith RW" // // The address information is intended for a human to read, not for a // computer to process. You can list multiple phone numbers with notes: // Phone // "+1 301 123 4567 (office)" // "+1 240 765 4321 (cell)" // //----------------------------------------------------------------------------- // Tags removed from Author: // // Details Surname UNIQUE Text // Firstname UNIQUE Text // Initial UNIQUE Text // Laboratory UNIQUE ?Laboratory XREF Representative // Address Mail Text // E_mail Text // Phone Text // Fax Text // Specialist ?Gene XREF Specialist //----------------------------------------------------------------------------- //----------------------------------------------------------------------------- ?Tissue Title Text ?Gene_class Main_name ?Gene_class XREF Other_name Other_name ?Gene_class XREF Main_name ID Description UNIQUE ?Locus_description XREF Gene_class Specialist ?Person XREF Gene_class Remark Text Designating_laboratory UNIQUE ?Laboratory XREF Gene_classes Type UNIQUE Genetic Molecular Loci ?Locus XREF Gene_class Reference ?Paper XREF Gene_class // comparison to wormbase WS85 // we throw away Allele ?Allele XREF Gene_class // CGC_approved // added by krb 24/01/02 // CGC_unresolved Text // added by krb 28/01/02 // Phenotype we copy under description // if phenotype != "", type = genetic