ncbi logo
UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:9216 Links
STS-N20593
Homo sapiens chromosome 3, locus NAT13
Pan troglodytes chromosome 3, locus NAT13

Found by e-PCR in sequences from Homo sapiens and Pan troglodytes.

Primer InformationHelp

Forward primer:ACCGCAATTTTACATAAGAGG
Reverse primer:CGGAGTGGCTTTGACAG
PCR product size:196 (bp), Homo sapiens
GenBank Accession:N20593

   Homo sapiens
Name: STS-N20593
Also known as: SHGC-77215 sts-N20593
Polymorphism info:  

Cross References Help
Gene GeneID:80218
 Symbol:NAT13
 Description:N-acetyltransferase 13 (GCN5-related)
 Position:3q13.2
UniGeneHs.654706 N-acetyltransferase 13

Mapping InformationHelp
STS-N20593 Sequence Map: Chr 3|HuRef Map Viewer
  Position: 110814020-110814215 (bp)
 
STS-N20593 Sequence Map: Chr 3|Celera Map Viewer
  Position: 111847611-111847806 (bp)
 
STS-N20593 Sequence Map: Chr 3 Map Viewer
  Position: 114921810-114922005 (bp)
 
sts-N20593 NCBI RH Map: Chr 3 Map Viewer
  Position: 927.8 (cR)
  Lod score: 1.06
 
SHGC-77215 TNG Map: Chr 3 Map Viewer
  Position: 12580 (cR50000)
  Lod score: 6.4
  Reference Interval: 32
 
sts-N20593 GeneMap99-GB4 Map: Chr 3 Map Viewer
  Position: 411.49 (cR3000)
  Lod score: 3.00
  Reference Interval: D3S1610-D3S1278

Electronic PCR results Help
RefSeq mRNA (1)
NM_025146.1 2102 .. 2297 (196 bp)  
 
mRNA (4)
AK022540.1 1458 .. 1653 (196 bp)  
AK023090.1 2066 .. 2261 (196 bp)  
AK023256.1 2102 .. 2297 (196 bp)  
BC012731.2 2091 .. 2286 (196 bp)  
 
Genomic (5 of 8)[Show All Hits]
AC108693.5 71493 .. 71688 (196 bp)  
CH003450.1 111090977 .. 111091172 (196 bp)  
CH003498.1 117126017 .. 117126212 (196 bp)  
BV174793.1 2088 .. 2283 (196 bp)  
CH471052.2 20033281 .. 20033476 (196 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (1)
AC019247.4 100199 .. 100394 (196 bp)  
 
ESTs (5 of 57)[Show All Hits]
H98004.1 65 .. 260 (196 bp)  
N20593.1 65 .. 260 (196 bp)  
AA913039.1 69 .. 264 (196 bp)  
AI653586.1 67 .. 262 (196 bp)  
AI671930.1 71 .. 266 (196 bp)  
 
Whole Genome Shotgun sequences (4)
AADD01036579.1 17174 .. 17369 (196 bp)  
AADC01032401.1 16385 .. 16580 (196 bp)  
AADB02004627.1 64357 .. 64552 (196 bp)  
ABBA01061650.1 52223 .. 52418 (196 bp)  
 

   Pan troglodytes
Name: STS-N20593
Polymorphism info:  

Cross References Help
Gene GeneID:470884
 Symbol:NAT13
 Description:N-acetyltransferase 13 (GCN5-related)
 Position: 

Mapping InformationHelp
STS-N20593 Sequence Map: Chr 3 Map Viewer
  Position: 117940865-117941060 (bp)

Electronic PCR results Help
RefSeq mRNA (1)
XM_526267.2 2018 .. 2213 (196 bp)  
 
Genomic (1)
CM000317.1 117940865 .. 117941060 (196 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01069692.1 15053 .. 15248 (196 bp)  
AACZ02039308.1 21542 .. 21737 (196 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement