PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:24157 Links D6S1463 Homo sapiens chromosome 6, locus TRERF1 Pan troglodytes chromosome 6, locus TRERF1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CACAGGATCTGTGGTTGTGG Reverse primer: TGAACACCTGGGGAAGAAAG PCR product size: 193-194 (bp), Homo sapiens GenBank Accession: G04480    Homo sapiens Name: D6S1463 Also known as: GDB:588966 MR5839 WI-3933 stSG6152 Polymorphism info:   Cross References Gene GeneID: 55809   Symbol: TRERF1   Description: transcriptional regulating factor 1   Position: 6p21.1-p12.1 Mapping Information D6S1463 Sequence Map: Chr 6|HuRef Map Viewer   Position: 41918418-41918611 (bp)   D6S1463 Sequence Map: Chr 6 Map Viewer   Position: 42308602-42308795 (bp)   D6S1463 Sequence Map: Chr 6|Celera Map Viewer   Position: 43753067-43753260 (bp)   WI-3933 NCBI RH Map: Chr 6 Map Viewer   Position: 633.7 (cR)   Lod score: 1.34   WI-3933 Whitehead-RH Map: Chr 6 Map Viewer   Position: 256.7 (cR3000)   Lod score: P0.38   WI-3933 Whitehead-YAC Map: Chr 6 Map Viewer   Reference Interval: WC6.5 Electronic PCR results Genomic (5 of 8)[Show All Hits] G04480.1 69 .. 262 (194 bp)   AL096814.26 67136 .. 67329 (194 bp)   CH003453.1 42597234 .. 42597427 (194 bp)   CH003501.1 43938643 .. 43938836 (194 bp)   CH471081.1 15217388 .. 15217581 (194 bp)     Whole Genome Shotgun sequences (4) AADD01069211.1 9544 .. 9737 (194 bp)   AADC01059523.1 100197 .. 100390 (194 bp)   AADB02010025.1 2771609 .. 2771802 (194 bp)   ABBA01050732.1 82771 .. 82964 (194 bp)        Pan troglodytes Name: D6S1463 Polymorphism info:   Cross References Gene GeneID: 462695   Symbol: TRERF1   Description: transcriptional regulating factor 1   Position:   Mapping Information D6S1463 Sequence Map: Chr 6 Map Viewer   Position: 43207656-43207849 (bp) Electronic PCR results Genomic (1) CM000320.1 43207656 .. 43207849 (194 bp)     Whole Genome Shotgun sequences (2) AADA01319183.1 4574 .. 4767 (194 bp)   AACZ02071276.1 546 .. 739 (194 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement