refSNP ID: rs3177777 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 105/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/C Ancestral Allele: A Clinical Association: unknown HGVS Names NM_006579.1:c.*253A>C NT_079573.3:g.11238865A>C Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss4394180 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3177777 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss4394180 LEE|ge358363 fwd/T A/C atttttaaaatcaggaaataaaagatcttg ctctaacactgagagatccttaattactaa 04/25/02 10/10/03 105 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs3177777|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='A/C'|mol=cDNA|build=105 GGAGGTCTAT GATGGTGACG ATTTTTAAAA TCAGGAAATA AAAGATCTTG M CTCTAACACT GAGAGATCCT TAATTACTAA CCCCAGAGAT GCGCTATGAC   GeneView GeneView via analysis of contig annotation: EBP emopamil binding protein (sterol isomerase) View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_079573->NM_006579 function HuRef NW_001842363->NM_006579 function Celera NW_927703->NM_006579 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_079573->NM_006579-> 11238865 forward 1058 3' UTR HuRef NW_001842363->NM_006579-> 100192 forward 1058 3' UTR Celera NW_927703->NM_006579-> 788877 reverse 1058 3' UTR GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs3177777 maps exactly once on NCBI human chromosome X Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position X NW_001842363.1 100192 46050385 plus A alt_assembly_8 HuRef HuRef view 50 X NT_079573.3 11238865 48272042 plus A ref_assembly reference reference view 50 X NW_927703.1 788877 53278633 minus T alt_assembly_1 Celera Celera view 50   NCBI Resource Links Submitter-Referenced GenBank AI057610 Hs.75105 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank HTGS Finished: NM_006579.1 AF196969.3 AF196972.1 UniGene Cluster ID 522636   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .