PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:29091 Links D12S98 Homo sapiens chromosome 12 Pan troglodytes chromosome 12 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CCAAAACCTCCTGAACTCTT Reverse primer: GTTGGTGACACCTAAATCACA PCR product size: 176 (bp), Homo sapiens    Homo sapiens Name: D12S98 Also known as: AFM211wb6 stSG718 Polymorphism info:   Cross References Mapping Information D12S98 Sequence Map: Chr 12|HuRef Map Viewer   Position: 11864922-11865101 (bp)   D12S98 Sequence Map: Chr 12 Map Viewer   Position: 11990772-11990947 (bp)   D12S98 Sequence Map: Chr 12|Celera Map Viewer   Position: 17242570-17242749 (bp)   AFM211WB6 NCBI RH Map: Chr 12 Map Viewer   Position: 177.8 (cR)   Lod score: 1.41 Electronic PCR results Genomic (5 of 9)[Show All Hits] Z16962.1 129 .. 304 (176 bp)   U59962.1 11409 .. 11590 (182 bp)   AC091816.8 84257 .. 84432 (176 bp)   CH003459.1 15657939 .. 15658118 (180 bp)   CH003507.1 11406704 .. 11406883 (180 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC022222.34 159922 .. 160097 (176 bp)     Whole Genome Shotgun sequences (4) AADD01121767.1 45839 .. 46018 (180 bp)   AADC01103731.1 462419 .. 462598 (180 bp)   AADB02014687.1 99979 .. 100158 (180 bp)   ABBA01067827.1 46912 .. 47091 (180 bp)        Pan troglodytes Name: D12S98 Polymorphism info:   Mapping Information D12S98 Sequence Map: Chr 12 Map Viewer   Position: 12336648-12336841 (bp) Electronic PCR results Genomic (1) CM000326.1 12336648 .. 12336841 (194 bp)     BAC-ends (1) AG078213.1 301 .. 492 (192 bp)     Whole Genome Shotgun sequences (2) AADA01115074.1 445 .. 638 (194 bp)   AACZ02132133.1 84298 .. 84491 (194 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement