PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:76323 Links D8S1719 Homo sapiens chromosome 8, polymorphic Pan troglodytes chromosome 8, locus UNC5D Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TTAACCTGAGACACCTGTTCC Reverse primer: GCTAAAATTGCCATAGTTTATGA PCR product size: 267-275 (bp), Homo sapiens GenBank Accession: Z52439    Homo sapiens Name: D8S1719 Also known as: A192XD5 AFMA192XD5 AFMa192xd5 GDB:606154 HSA192XD5 W5636 Polymorphism info: on genetic map Mapping Information D8S1719 Sequence Map: Chr 8|HuRef Map Viewer   Position: 33932057-33932323 (bp)   D8S1719 Sequence Map: Chr 8|Celera Map Viewer   Position: 34347998-34348266 (bp)   D8S1719 Sequence Map: Chr 8 Map Viewer   Position: 35517451-35517717 (bp)   D8S1719 deCODE Map: Chr 8 Map Viewer   Position: 54.91 (cM)   AFMa192xd5 Genethon Map: Chr 8 Map Viewer   Position: 60.60 (cM)   AFMa192xd5 Marshfield Map: Chr 8 Map Viewer   Position: 61.40 (cM)   D8S1719 Whitehead-YAC Map: Chr 8 Map Viewer   Reference Interval: WC8.5 Electronic PCR results Genomic (5 of 9)[Show All Hits] Z52439.1 33 .. 301 (269 bp)   AF216808.7 115451 .. 115719 (269 bp)   AC013302.14 71771 .. 72037 (267 bp)   CH003455.1 34054479 .. 34054744 (266 bp)   CH003503.1 44805111 .. 44805377 (267 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AC016340.3 109421 .. 109691 (271 bp)   AC090705.2 47760 .. 48028 (269 bp)   AC016275.6 48792 .. 49062 (271 bp)     Working Draft phase 2 (from GenBank HTGS division) (2) AC084129.2 52488 .. 52755 (268 bp)   AC129984.1 115851 .. 116119 (269 bp)     Whole Genome Shotgun sequences (4) AADD01090249.1 7681 .. 7946 (266 bp)   AADC01075239.1 5965 .. 6231 (267 bp)   AADB02011233.1 290704 .. 290972 (269 bp)   ABBA01023585.1 100157 .. 100423 (267 bp)        Pan troglodytes Name: D8S1719 Polymorphism info:   Cross References Gene GeneID: 472737   Symbol: UNC5D   Description: unc-5 homolog D (C. elegans)   Position:   Mapping Information D8S1719 Sequence Map: Chr 8 Map Viewer   Position: 32256510-32256770 (bp) Electronic PCR results Genomic (1) CM000322.2 32256510 .. 32256770 (261 bp)     Whole Genome Shotgun sequences (2) AADA01241831.1 9620 .. 9878 (259 bp)   AACZ02093828.1 28656 .. 28916 (261 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement