PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:132358 Links RH120153 Homo sapiens chromosome 11, locus KCNJ1 Pan troglodytes chromosome 11, locus KCNJ1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CTGAAGAACAGTCACCAACTGGA Reverse primer: CTTCGTCTCCCAGATAGGGAAAT PCR product size: 340 (bp), Homo sapiens GenBank Accession: G54959    Homo sapiens Name: RH120153 Also known as: SHGC-100155 Polymorphism info:   Cross References Gene GeneID: 3758   Symbol: KCNJ1   Description: potassium inwardly-rectifying channel, subfamily J, member 1   Position: 11q24 Mapping Information RH120153 Sequence Map: Chr 11|HuRef Map Viewer   Position: 124678160-124678499 (bp)   RH120153 Sequence Map: Chr 11|Celera Map Viewer   Position: 125896587-125896926 (bp)   RH120153 Sequence Map: Chr 11 Map Viewer   Position: 128235659-128235998 (bp)   SHGC-100155 TNG Map: Chr 11 Map Viewer   Position: 60583 (cR50000)   Lod score: 12.8   Reference Interval: 156 Electronic PCR results Genomic (5 of 10)[Show All Hits] U65406.1 7449 .. 7789 (341 bp)   G54959.1 113 .. 452 (340 bp)   AP000920.4 24342 .. 24681 (340 bp)   AP001122.5 212020 .. 212359 (340 bp)   CH003458.1 125645918 .. 125646257 (340 bp)     Whole Genome Shotgun sequences (4) AADD01120392.1 12295 .. 12634 (340 bp)   AADC01102748.1 8025 .. 8364 (340 bp)   AADB02014415.1 382049 .. 382388 (340 bp)   ABBA01023014.1 24458 .. 24797 (340 bp)        Mus musculus   Polymorphism info:   Cross References    Pan troglodytes Name: RH120153 Polymorphism info:   Cross References Gene GeneID: 466846   Symbol: KCNJ1   Description: potassium inwardly-rectifying channel, subfamily J, member 1   Position:   Mapping Information RH120153 Sequence Map: Chr 11 Map Viewer   Position: 127912751-127913090 (bp) Electronic PCR results Genomic (1) CM000325.1 127912751 .. 127913090 (340 bp)     Whole Genome Shotgun sequences (2) AADA01028357.1 12170 .. 12509 (340 bp)   AACZ02129368.1 12255 .. 12594 (340 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement