PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:468 Links STS-H84808 Homo sapiens chromosome 15 Pan troglodytes chromosome 15 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: AAAAGCACTCCATGTTTCTGCCG Reverse primer: ACTCTTTGAAATACCTCCAGAGGCG PCR product size: 121 (bp), Homo sapiens    Homo sapiens Name: STS-H84808 Also known as: sts-H84808 Polymorphism info:   Cross References UniGene Hs.511837 Transcribed locus, strongly similar to NP_001020028.1 tau tubulin kinase 1 i...   Hs.656863 CDNA clone IMAGE:5272626 Mapping Information STS-H84808 Sequence Map: Chr 15|Celera Map Viewer   Position: 19799259-19799379 (bp)   STS-H84808 Sequence Map: Chr 15|HuRef Map Viewer   Position: 19879917-19880037 (bp)   STS-H84808 Sequence Map: Chr 15 Map Viewer   Position: 40818619-40818739 (bp)   sts-H84808 NCBI RH Map: Chr 15 Map Viewer   Position: 172.2 (cR)   Lod score: 2.52   sts-H84808 GeneMap99-GB4 Map: Chr 15 Map Viewer   Position: 155.57 (cR3000)   Lod score: 3.00   Reference Interval: D15S146-D15S117 Electronic PCR results mRNA (1) BC045644.1 1423 .. 1543 (121 bp)     Genomic (5 of 7)[Show All Hits] AC090510.4 100147 .. 100267 (121 bp)   CH003462.1 18926469 .. 18926589 (121 bp)   CH003510.1 20951619 .. 20951739 (121 bp)   CH471125.1 10082028 .. 10082148 (121 bp)   CM000266.1 19799259 .. 19799379 (121 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC016400.1 54772 .. 54892 (121 bp)   AC106723.4 232817 .. 232937 (121 bp)     ESTs (5 of 37)[Show All Hits] H84808.1 131 .. 251 (121 bp)   H95097.1 135 .. 255 (121 bp)   H95102.1 129 .. 249 (121 bp)   H97508.1 160 .. 280 (121 bp)   N23323.1 159 .. 279 (121 bp)     Whole Genome Shotgun sequences (4) AADD01142704.1 9985 .. 10105 (121 bp)   AADC01120174.1 746 .. 866 (121 bp)   AADB02016421.1 150042 .. 150162 (121 bp)   ABBA01038365.1 15327 .. 15447 (121 bp)        Pan troglodytes Name: STS-H84808 Polymorphism info:   Mapping Information STS-H84808 Sequence Map: Chr 15 Map Viewer   Position: 39845507-39845627 (bp) Electronic PCR results Genomic (1) CM000329.1 39845507 .. 39845627 (121 bp)     Whole Genome Shotgun sequences (2) AADA01359510.1 1497 .. 1617 (121 bp)   AACZ02154463.1 2428 .. 2548 (121 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement