PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:57343 Links RH18473 Homo sapiens chromosome X Pan troglodytes chromosome X Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GTCTACTCTTATCCCCATGTAAA Reverse primer: AAACTCTTGACCATAGTTGACTC PCR product size: 106 (bp), Homo sapiens    Homo sapiens Name: RH18473 Also known as: A008A30 stSG10155 Polymorphism info:   Cross References Mapping Information RH18473 Sequence Map: Chr Un|NW_001841971.1|HuRef Map Viewer   Position: 5920-6025 (bp)   RH18473 Sequence Map: Chr X Map Viewer   Position: 118941503-118941608 (bp)   RH18473 Sequence Map: Chr X|Celera Map Viewer   Position: 119512104-119512209 (bp)   stSG10155 NCBI RH Map: Chr X Map Viewer   Position: 608.9 (cR)   Lod score: 1.04   stSG10155 GeneMap99-GB4 Map: Chr X Map Viewer   Position: 298.19 (cR3000)   Lod score: 0.00   Reference Interval: DXS1059-DXS1047 Electronic PCR results Genomic (5 of 7)[Show All Hits] AC002477.1 100037 .. 100142 (106 bp)   CH003470.1 113793333 .. 113793438 (106 bp)   CH003518.1 91524044 .. 91524149 (106 bp)   CH471161.2 3323446 .. 3323551 (106 bp)   CM000274.1 119512104 .. 119512209 (106 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AC207715.2 1480 .. 1585 (106 bp)   AC207715.2 26185 .. 26290 (106 bp)   AC211855.3 17432 .. 17537 (106 bp)     Working Draft phase 2 (from GenBank HTGS division) (1) AL589985.3 135793 .. 135898 (106 bp)     ESTs (2) T74084.1 90 .. 195 (106 bp)   F12533.1 117 .. 222 (106 bp)     Whole Genome Shotgun sequences (4) AADD01195383.1 347 .. 452 (106 bp)   AADC01147951.1 10415 .. 10520 (106 bp)   AADB02037205.1 226539 .. 226644 (106 bp)   ABBA01179529.1 5920 .. 6025 (106 bp)        Pan troglodytes Name: RH18473 Polymorphism info:   Mapping Information RH18473 Sequence Map: Chr X Map Viewer   Position: 119403445-119403550 (bp) Electronic PCR results Genomic (1) CM000336.1 119403445 .. 119403550 (106 bp)     Whole Genome Shotgun sequences (2) AADA01130926.1 1346 .. 1451 (106 bp)   AACZ02219306.1 1295 .. 1400 (106 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement