refSNP ID: rs1044035 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 86/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: C Clinical Association: unknown HGVS Names NM_018346.1:c.*1039C>T NT_010783.14:g.7216539C>T Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss1512749 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs1044035 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss1512749 LEE|100138 fwd/B C/T attcgggaaagacccaaagtgtttgtaatt ttctttgtccttttacctacagaaatggtc 09/13/00 10/10/03 86 cDNA unknown ss4406147 LEE|e100138 fwd/B C/T attcgggaaagacccaaagtgtttgtaatt ttctttgtccttttacctacagaaatggtc 04/26/02 10/10/03 106 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs1044035|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='C/T'|mol=cDNA|build=106 GACCAGAGAA AGGGGAGAGA ATTCGGGAAA GACCCAAAGT GTTTGTAATT Y TTCTTTGTCC TTTTACCTAC AGAAATGGTC ACATGGTTCT ATTTAAATAG   GeneView GeneView via analysis of contig annotation: RSAD1 radical S-adenosyl methionine domain containing 1 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_010783->NM_018346 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_010783->NM_018346-> 7216539 forward 2424 3' UTR GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs1044035 maps exactly once on NCBI human chromosome 17 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 17 NW_001838448.1 3799160 43931180 plus C alt_assembly_8 HuRef HuRef view 50 17 NW_926894.1 2955580 45024558 plus C alt_assembly_1 Celera Celera view 50 17 NT_010783.14 7216539 45918260 plus C ref_assembly reference reference view 50   NCBI Resource Links Submitter-Referenced GenBank AI185347 Hs.8033 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank mRNA: NM_018346.1 AK002026.1 AK022105.1 BC050538.1 UniGene Cluster ID 8033   Population Diversity Sample Ascertainment Genotypes Alleles ss# Population Individual Group Chrom. Sample Cnt. Source HWP C T ss1512749 CEPH 184 AF 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0 0 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .