PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:65087 Links RH78712 Homo sapiens chromosome 11, locus SLC22A9 Macaca mulatta chromosome 14, locus LOC722193 Pan troglodytes chromosome 11, locus SLC22A9 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TCAGGCCTGTAAGCACTGG Reverse primer: AGAAGCCCAAAATTAGGTCTCC PCR product size: 173 (bp), Homo sapiens    Homo sapiens Name: RH78712 Also known as: stSG42284 Polymorphism info:   Cross References Gene GeneID: 114571   Symbol: SLC22A9   Description: solute carrier family 22 (organic anion transporter), member 9   Position: 11q13.1 Mapping Information RH78712 Sequence Map: Chr 11|HuRef Map Viewer   Position: 59505439-59505611 (bp)   RH78712 Sequence Map: Chr 11|Celera Map Viewer   Position: 60500686-60500858 (bp)   RH78712 Sequence Map: Chr 11 Map Viewer   Position: 62933173-62933345 (bp)   stSG42284 NCBI RH Map: Chr 11 Map Viewer   Position: 563 (cR)   Lod score: 2.05   stSG42284 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 235.21 (cR3000)   Lod score: 1.04   Reference Interval: D11S1357-D11S913 Electronic PCR results Genomic (5 of 7)[Show All Hits] AP000484.5 23852 .. 24024 (173 bp)   CH003458.1 61677401 .. 61677573 (173 bp)   CH003506.1 60176754 .. 60176926 (173 bp)   CH471076.1 8848762 .. 8848934 (173 bp)   CM000262.1 60500686 .. 60500858 (173 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AP002367.1 100138 .. 100310 (173 bp)   AC193167.1 25977 .. 26149 (173 bp)     ESTs (3) R98561.1 151 .. 324 (174 bp)   H57549.1 142 .. 314 (173 bp)   H95360.1 144 .. 316 (173 bp)     Whole Genome Shotgun sequences (4) AADD01116212.1 60625 .. 60797 (173 bp)   AADC01098873.1 26296 .. 26468 (173 bp)   AADB02014095.1 446841 .. 447013 (173 bp)   ABBA01003254.1 151341 .. 151513 (173 bp)        Macaca mulatta Name: RH78712 Polymorphism info:   Cross References Gene GeneID: 722193   Symbol: LOC722193   Description: similar to solute carrier family 22 (organic anion/cation transporter), member 9   Position:   Mapping Information RH78712 Sequence Map: Chr 14 Map Viewer   Position: 11024729-11024901 (bp)    Pan troglodytes Name: RH78712 Polymorphism info:   Cross References Gene GeneID: 466643   Symbol: SLC22A9   Description: solute carrier family 22 (organic anion transporter), member 9   Position:   Mapping Information RH78712 Sequence Map: Chr 11 Map Viewer   Position: 61796125-61796297 (bp) Electronic PCR results RefSeq mRNA (1) XM_522042.2 2221 .. 2393 (173 bp)     Genomic (1) CM000325.1 61796125 .. 61796297 (173 bp)     Whole Genome Shotgun sequences (2) AADA01241835.1 14699 .. 14871 (173 bp)   AACZ02125098.1 11489 .. 11661 (173 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement