PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:48597 Links D6S1570 Homo sapiens chromosome 6, polymorphic Macaca mulatta chromosome 4 Found by e-PCR in sequences from Homo sapiens. Primer Information Forward primer: GCCATTCAGTAAAGTCTCCC Reverse primer: TCTGGGGTGGAAAACATC PCR product size: 121-145 (bp), Homo sapiens GenBank Accession: Z52576    Homo sapiens Name: D6S1570 Also known as: A223WD9 AFMa223wd9 GDB:602072 GDB:607215 HSA223WD9 SHGC-21939 W5757 stSG7061 Polymorphism info: on genetic map Cross References Mapping Information D6S1570 Sequence Map: Chr 6|HuRef Map Viewer   Position: 88413208-88413346 (bp)   D6S1570 Sequence Map: Chr 6 Map Viewer   Position: 91250703-91250837 (bp)   D6S1570 Sequence Map: Chr 6|Celera Map Viewer   Position: 91614896-91615030 (bp)   D6S1570 deCODE Map: Chr 6 Map Viewer   Position: 98.48 (cM)   AFMa223wd9 Genethon Map: Chr 6 Map Viewer   Position: 99.00 (cM)   AFMa223wd9 Marshfield Map: Chr 6 Map Viewer   Position: 99.01 (cM)   SHGC-21939 TNG Map: Chr 6 Map Viewer   Position: 43543 (cR50000)   Lod score: 6.8   Reference Interval: 114   AFMa223wd9 GeneMap99-GB4 Map: Chr 6 Map Viewer   Position: 399.57 (cR3000)   Lod score: F   Reference Interval: D6S1644-D6S458   D6S1570 Whitehead-YAC Map: Chr 6 Map Viewer   Reference Interval: WC6.12 Electronic PCR results Genomic (5 of 8)[Show All Hits] Z52576.1 52 .. 184 (133 bp)   AL391559.13 85084 .. 85218 (135 bp)   CH003453.1 87812435 .. 87812573 (139 bp)   CH003501.1 91234745 .. 91234883 (139 bp)   CH471051.2 23683500 .. 23683634 (135 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AC025387.2 76077 .. 76199 (123 bp)   AL161435.8 157908 .. 158030 (123 bp)   AC018675.4 100136 .. 100256 (121 bp)     Whole Genome Shotgun sequences (4) AADD01072216.1 29682 .. 29820 (139 bp)   AADC01061823.1 29589 .. 29727 (139 bp)   AADB02010117.1 4504231 .. 4504365 (135 bp)   ABBA01040551.1 29617 .. 29755 (139 bp)        Macaca mulatta Name: D6S1570 Polymorphism info:   Mapping Information D6S1570 Sequence Map: Chr 4 Map Viewer   Position: 86376474-86376586 (bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement