refSNP ID: rs3027537 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 102/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/C Ancestral Allele: Not available Clinical Association: unknown HGVS Names NM_000489.3:c.6699+9127G>T NM_138270.2:c.6585+9127G>T NT_011651.16:g.100103C>A NT_113965.1:g.219089C>A XM_001128623.2:c.6705+9016G>T Links SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss4258487 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3027537 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss4258487 ACEVAN|ABACUS5561 fwd/T A/C ccgttattttttctggtggtctattcatat cagatgaataacaatcattttatactagta 11/07/01 10/10/03 102 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs3027537|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='A/C'|mol=Genomic|build=102 TCAAACAATT TTTCTGATGC CCGTTATTTT TTCTGGTGGT CTATTCATAT M CAGATGAATA ACAATCATTT TATACTAGTA AATACAAAGA TAGGAATAAT   GeneView GeneView via analysis of contig annotation: ATRX alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit GeneView via analysis of contig annotation: LOC728849 similar to putative DNA dependent ATPase and helicase View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_011651->NM_000489 function reference NT_011651->NM_138270 function reference NT_113965->XM_001128623 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_011651->NM_000489->NP_000480 100103 reverse intron reference NT_011651->NM_138270->NP_612114 100103 reverse intron reference NT_113965->XM_001128623->XP_001128623 219089 reverse intron GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs3027537 maps exactly once on NCBI human chromosome X Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position X NT_113965.1 219089 unplaced plus C ref_assembly reference reference view 50 X NW_001842376.2 712117 70392059 minus G alt_assembly_8 HuRef HuRef view 50 X NT_011651.16 100103 76690451 plus C ref_assembly reference reference view 50 X NW_927713.1 4564889 77044693 plus C alt_assembly_1 Celera Celera view 50   NCBI Resource Links Submitter-Referenced GenBank NT002821_011 dbSNP Blast Analysis GenBank HTGS Finished: GenBank HTGS Draft: AL109753.9 BX276116.7   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN YES

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .