Join Evaluation Legend

Serious alignment problem, requires review. (details...)
- Zero, or more than one, overlaps
- Half dove-tail >50 bp
- Alignment identity <98%
- Alignment length <100 bp
- >2 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Minor alignment problem. (details...)
- Exactly one overlap
- Half dove-tail >0 bp and <=50bp
- Alignment identity <99.1%
- Alignment length <2000 bp
- >0 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Excellent alignment, meets all defined criteria. (details...)
- Exactly one RuleInfo
- Half dove-tail <=0 bp
- Alignment identity >=99.1%
- Alignment length >=2000 bp
- <=0 gaps, each gap >25 bp, not marked as an SSR
- <=0 gaps, each gap >50 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, marked as an SSR
Certificate submitted, not yet approved.
Certificate submitted and approved.
Valid, contained clone
Join not evaluated due to one accession not being finished.

Curator Links

Add/Update certificate

Alignment for AL954135.7 and AL844609.6

AL954135.7 Mouse DNA sequence from clone RP23-231H10 on chromosome 4, complete sequence [htgs_phase3]

Length: 100,102 bp

AL844609.6 Mouse DNA sequence from clone RP23-356F8 on chromosome 4 Contains a novel transcript, a putative transcript, the 5'end of a novel protein (2310009E04Rik) and one CpG island, complete sequence [htgs_phase3]

Length: 191,676 bp

Alignment Summary

Join evaluation: green

Alignment count: 1

Go to Endhit Table

Alignment 1
Align ID: 3840
Total Length: 2000
Aligned Length: 2000
Percent Identity: 100
Number of Gaps: 0
Number of Mismatches: 0
Source: CtgOverlap Seq-Align
Valid Switchpoint: true (A)

Alignment 1 of 1

 Mismatches = 0, Gaps = 0, Length = 2000
 Percent identity = 100%
 Score = 3965 bits (2000), Expect = 0
  2 BAC and 1 Fosmid bridging clones.
  2 BAC and 1 Fosmid concordant clones.
  0 BAC and 0 Fosmid discordant clones.

AL954135.7 >98103   gaattcaactcagaatccaaccattatattgctcattttggtttactcgtattataaaat 98162  
AL844609.6 <191676  ............................................................ 191617 

AL954135.7 >98163   gctcatattctttcatatttatcacttggcttaatattatcatgccaggcactggtctag 98222  
AL844609.6 <191616  ............................................................ 191557 

AL954135.7 >98223   gcatgtacacaacaaggaaagagacatacatagctctgccaacgcagaaaactattacta 98282  
AL844609.6 <191556  ............................................................ 191497 

AL954135.7 >98283   aggggagttattagtgtaaggcatttgcttgaagaagatctaggtaggctgagttgactc 98342  
AL844609.6 <191496  ............................................................ 191437 

AL954135.7 >98343   tgtccactcgggactattaagatggaatgagatggtaagagtagcctctggcccagggta 98402  
AL844609.6 <191436  ............................................................ 191377 

AL954135.7 >98403   tgtgctcacaattgctctctctctccctctactaacaacacttcctaaagtccctcaggc 98462  
AL844609.6 <191376  ............................................................ 191317 

AL954135.7 >98463   ctgactctgcctcctgtctagccatctcactcctttatgtcagcctcctatagccacttt 98522  
AL844609.6 <191316  ............................................................ 191257 

AL954135.7 >98523   ccaccagggaccacagggctctgatcagtgccctactctgacaccatcagagaagcatct 98582  
AL844609.6 <191256  ............................................................ 191197 

AL954135.7 >98583   tcttgcagtacttaagaactaacacagagacccacaactgcacaatgtctagaaagtgag 98642  
AL844609.6 <191196  ............................................................ 191137 

AL954135.7 >98643   agattttggagtattcagtcctaaatgagatgcctttatcaaataccttccttcatggca 98702  
AL844609.6 <191136  ............................................................ 191077 

AL954135.7 >98703   gaggaggcagaggttgtaagagccagagagaattgaccaagaaagcaacatcttccagat 98762  
AL844609.6 <191076  ............................................................ 191017 

AL954135.7 >98763   ataacaggactaatgcacataagaattcagaggctgaggctccacacacaggaccacaca 98822  
AL844609.6 <191016  ............................................................ 190957 

AL954135.7 >98823   ggtttaagtcagatggggtcccagtgctgagaaagagaagtgggcatggacccaccccac 98882  
AL844609.6 <190956  ............................................................ 190897 

AL954135.7 >98883   ttctaaccaaaagctatctgcaattgacccctgtttgcaaaggaaaagatggtttctcca 98942  
AL844609.6 <190896  ............................................................ 190837 

AL954135.7 >98943   atggagtctcactgggtatactaatcactcttcaatgtacaactcatgcccaagcgtagc 99002  
AL844609.6 <190836  ............................................................ 190777 

AL954135.7 >99003   tggctaacacaaagtaaaaacaggtgtttatgtctcaaattgctttgtctggacattttc 99062  
AL844609.6 <190776  ............................................................ 190717 

AL954135.7 >99063   ttttcttttcttatcattttttctagtatattttggtttctgtttttgtggtgtgtgtgt 99122  
AL844609.6 <190716  ............................................................ 190657 

AL954135.7 >99123   gtgcctgtgcccatgcacccacacacttgcatgtatgtgtacatacgtgtatatctgtct 99182  
AL844609.6 <190656  ............................................................ 190597 

AL954135.7 >99183   gttttgttggtttatttgttgtttgtttttgaagaaataaaagagatgtggaattagata 99242  
AL844609.6 <190596  ............................................................ 190537 

AL954135.7 >99243   catgaaaagaaactggggaagggaaaaatatcaaaatatattttatgaaaaattgtttcc 99302  
AL844609.6 <190536  ............................................................ 190477 

AL954135.7 >99303   ttcaattaaaaaagaaaaacccacagagctaacagtcttggatttcatgttttgttgtat 99362  
AL844609.6 <190476  ............................................................ 190417 

AL954135.7 >99363   atgaagtaatcctatactagcaactacagaaagaactgtttcagggaaacttgccttgtg 99422  
AL844609.6 <190416  ............................................................ 190357 

AL954135.7 >99423   gagcctttgaaaacagagctctttctgaaacttgcttcaatagccggctatagtagcaga 99482  
AL844609.6 <190356  ............................................................ 190297 

AL954135.7 >99483   atggctgaagcagggccaccaggtcaagagaacttctatagaacttgatcttccaatgaa 99542  
AL844609.6 <190296  ............................................................ 190237 

AL954135.7 >99543   taccagccagacatcccttggaggaaatggccatgtgctgattgatgcttggccacaagt 99602  
AL844609.6 <190236  ............................................................ 190177 

AL954135.7 >99603   tatactttggaggcttaaacctagtgttgtatttggctctgcattcttatggctcatctg 99662  
AL844609.6 <190176  ............................................................ 190117 

AL954135.7 >99663   agagatgagccggaacatgcctcccatgtgaatgctctcatgatgatatgaaagaactag 99722  
AL844609.6 <190116  ............................................................ 190057 

AL954135.7 >99723   catttaaatgattggccaagctaggtcatcaaatactgttcattaactgttagagcaata 99782  
AL844609.6 <190056  ............................................................ 189997 

AL954135.7 >99783   tttctcagcaattaacagtatttatagccctggtggtcacatagcattccctctctagtc 99842  
AL844609.6 <189996  ............................................................ 189937 

AL954135.7 >99843   cttccatattctacaggcagtatgagcttagaactaaggatccaagttccatgaatacag 99902  
AL844609.6 <189936  ............................................................ 189877 

AL954135.7 >99903   aaactggtgaatctcatcctttgttgtacctccagagaatccctaattgaagtagaaatg 99962  
AL844609.6 <189876  ............................................................ 189817 

AL954135.7 >99963   cattagatattaagtggaagaatatattgtaggagagagacaaataaatatgtagtgtgc 100022 
AL844609.6 <189816  ............................................................ 189757 

AL954135.7 >100023  atgaacaaaggccagaatggtgaagagaccaaagccacagtactacatttggcattctgg 100082 
AL844609.6 <189756  ............................................................ 189697 

AL954135.7 >100083  agcacagagggtatctagta 100102 
AL844609.6 <189696  .................... 189677

Switch Points

Type	Point1	Point2	Orient1	Orient2	Curator	Comment	Time
A	100102	189676	+	-	chenhc	Taxid 10090 chrom 4 Reference assembly	2008-11-20 16:51:55.503

Events

Id	Type	Date	Whodid	Comment
7245	ImportOldDb	09/02/2005 17:32:00	f_old_db
7246	ReSetShortOvlp	09/04/2008 10:31:48	dbo
168490	CreateSwitchPt	11/20/2008 16:51:55	chenhc	tpf_builder 1.6 Toolkit wrapper version: built Nov 19 2008 using /netopt/ncbi_tools64/c++.by-date/20081119/GCC401-Release64/lib

BAC Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
C3H-163N16	AL844609.6	99.87%	pos 162668 (R+)
CH29-14I18				AL954135.7	100%	pos 21159 (F+)
CH29-27B21	AL844609.6	99.26%	pos 141909 (R+)
CH29-525O8	AL954135.7	99.61%	pos 60709 (R-)
CH29-606K21	AL954135.7	99.16%	pos 2065 (R+)	AL844609.6	99.01%	pos 112326 (F+)
CH29-616M8	AL844609.6	99.08%	pos 6740 (R+)	AL954135.7	99.51%	pos 60825 (F+)
CH29-98B8	AL844609.6	99.85%	pos 106639 (R+)
RP23-25I18				AL844609.6	99.02%	pos 53229 (F-)
RP24-145G15				AL954135.7	99.84%	pos 54302 (F-)
RP24-259N16	AL844609.6	100%	pos 104790 (R-)
RP24-265K22	AL844609.6	99.4%	pos 91150 (R-)
RP24-359I11	AL844609.6	99.5%	pos 175906 (R-)
RP24-90F13	AL954135.7	99.61%	pos 55166 (R+)

Fosmid Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
WI1-1178F10	AL954135.7	100%	pos 47764 (R-)
WI1-1208L24	AL954135.7	100%	pos 92126 (R-)	AL954135.7	99.82%	pos 53108 (F+)
WI1-1230L16	AL954135.7	100%	pos 92089 (R-)	AL954135.7	99.85%	pos 53126 (F+)
WI1-1233D14	AL844609.6	100%	pos 112151 (R+)	AL844609.6	100%	pos 153044 (F-)
WI1-1253L4	AL844609.6	99.13%	pos 72482 (R-)	AL844609.6	100%	pos 30771 (F+)
WI1-1404C15				AL954135.7	100%	pos 6417 (F-)
WI1-1404C15				AL954135.7	100%	pos 6418 (F-)
WI1-1468A19	AL844609.6	99.72%	pos 7499 (R-)
WI1-1567D1	AL954135.7	99.82%	pos 4228 (R-)
WI1-1715L10				AL954135.7	100%	pos 46554 (F-)
WI1-1722I23	AL954135.7	100%	pos 56223 (R+)	AL954135.7	99.85%	pos 94137 (F-)
WI1-1722K23	AL954135.7	100%	pos 56223 (R+)	AL954135.7	100%	pos 94150 (F-)
WI1-1774H7	AL954135.7	100%	pos 93998 (R-)	AL954135.7	100%	pos 54851 (F+)
WI1-1886P16	AL954135.7	100%	pos 10535 (R+)	AL954135.7	99.54%	pos 51207 (F-)
WI1-2018B17	AL844609.6	99.63%	pos 87354 (R+)	AL844609.6	99.53%	pos 127953 (F-)
WI1-211L24	AL954135.7	99.64%	pos 33255 (R-)
WI1-2214H4	AL844609.6	100%	pos 92962 (R-)	AL844609.6	99.67%	pos 57236 (F+)
WI1-2318H20				AL954135.7	100%	pos 55942 (F-)
WI1-2443F23				AL954135.7	99.74%	pos 34111 (F-)
WI1-2479N3	AL954135.7	100%	pos 50032 (R+)	AL954135.7	100%	pos 91873 (F-)
WI1-2488D10	AL844609.6	100%	pos 89633 (R+)
WI1-2489A22				AL954135.7	99.16%	pos 69636 (F+)
WI1-2511O14	AL844609.6	99.73%	pos 111861 (R+)	AL844609.6	100%	pos 152879 (F-)
WI1-2526G6	AL954135.7	99.17%	pos 92493 (R+)	AL844609.6	99.74%	pos 160022 (F+)
WI1-2684O15	AL844609.6	99.34%	pos 89633 (R+)
WI1-2697D8				AL844609.6	100%	pos 26863 (F-)
WI1-370I12	AL844609.6	99.77%	pos 129793 (R+)	AL844609.6	100%	pos 168425 (F-)
WI1-417O22				AL954135.7	99.83%	pos 14432 (F-)
WI1-436B19	AL844609.6	99.77%	pos 12796 (R-)
WI1-515K24	AL844609.6	100%	pos 107446 (R-)
WI1-525N10	AL954135.7	100%	pos 46684 (R-)	AL954135.7	99.22%	pos 8002 (F+)
WI1-525P8	AL954135.7	100%	pos 46684 (R-)	AL954135.7	100%	pos 8000 (F+)
WI1-543H20				AL954135.7	100%	pos 7392 (F-)
WI1-663K5	AL844609.6	99.25%	pos 158522 (R-)

NCBI

Join Evaluation Legend

Curator Links

Alignment for AL954135.7 and AL844609.6

Alignment Summary

Alignment 1 of 1