refSNP ID: rs3830980 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 107/129 Map to Genome Build: 36.3 Allele Variation Class: DIP: deletion/insertion polymorphism RefSNP Alleles: -/CCGCGA Ancestral Allele: Not available Clinical Association: unknown HGVS Names NM_001039592.1:c.28_33del6 NM_172312.1:c.28_33del6 NT_008413.17:g.35802112_35802117del6 Links SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss5017484 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3830980 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss5017484 YUSUKE|IMS-JST081562 fwd/B -/CCGCGA ccagagctgcggctctcaccgcgaccgcga tccctccgtagactcgttggtctccatctt 08/12/02 10/10/03 107 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs3830980|allelePos=61|totalLen=121|taxid=9606|snpclass=2|alleles='-/CCGCGA'|mol=Genomic|build=107 CTGACCTTCC TCGTCCCCTT ATGCCTGCAG CCAGAGCTGC GGCTCTCACC GCGACCGCGA N TCCCTCCGTA GACTCGTTGG TCTCCATCTT CAGACTCCAG CTACTGGGTT GCCATAGAGA   GeneView GeneView via analysis of contig annotation: SPAG8 sperm associated antigen 8 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit GeneView via analysis of contig annotation: HINT2 histidine triad nucleotide binding protein 2 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_008413->NM_001039592 function reference NT_008413->NM_172312 function reference NT_008413->NM_032593 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_008413->NM_001039592->NP_001034681 35802112:35802117 reverse 148 synonymous - 3 11 contig reference TCGCGG 3 11 reference NT_008413->NM_172312->NP_758516 35802112:35802117 reverse 148 synonymous - 3 11 contig reference TCGCGG 3 11 reference NT_008413->NM_032593->NP_115982 35802112:35802117 reverse 3' near gene GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs3830980 maps exactly once on NCBI human chromosome 9 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 9 NW_924062.1 35630163..35630168 35745644..35745649 plus CCGCGA alt_assembly_1 Celera Celera view 60 9 NW_001839149.2 100092..100097 35768124..35768129 minus TCGCGG alt_assembly_8 HuRef HuRef view 60 9 NT_008413.17 35802112..35802117 35802112..35802117 plus CCGCGA ref_assembly reference reference view 60   NCBI Resource Links Submitter-Referenced GenBank AL133410.20 dbSNP Blast Analysis GenBank HTGS Finished: AL133410.32   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .