MATERIALS AND METHODS Cell treatment and viability assay. H9c2 cardiomyocytes, a fetal cardiomyocyte-derived cell line (CRL-1446; American Type Culture Collection) were cultured at 5% CO 2 in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 μg/ml streptomycin, and 2 mM glutamine. The primary neonatal rat cardiomyocytes were isolated from the hearts of Wistar rats and cultured as described elsewhere ( 57). Hydrogen peroxide treatment was performed as described elsewhere ( 32). In brief, the cultured cells were incubated at 37°C for 1 h in Hanks' balanced salt solution containing the indicated concentrations of hydrogen peroxide. The reaction was stopped by removing the Hanks' balanced salt solution containing hydrogen peroxide. Anoxia was performed as described elsewhere ( 40). In brief, cells were placed in an anoxic chamber with a water-saturated atmosphere composed of 5% CO 2 and 95% N 2. Cell death was determined by trypan blue exclusion, and the numbers of trypan Blue-positive and -negative cells were counted on a hemocytometer. Constructions of rat ARC promoter and mutants, PUMA and Bad mutants, adenovirus ARC, adenovirus p53, ARC antisense oligonucleotides, and p53 RNA interference (RNAi). The ARC promoter (1,342 bp) immediately before the ARC translation starting code ATG was amplified from rat cardiomyocyte DNA using PCR. The forward primer was 5′-ACAAAGCGTCTGTCACATATG-3′. The reverse primer was 5′-TTGGGCTATATCAAGAAGGAGAGA-3′. The PCR fragment was cloned into the pcDNA 3.1 vector (Invitrogen) and then subcloned into the reporter plasmid pGL4.17 (Promega). Mutations of the two putative p53 binding sites (BS1 wild type, 5′-GGGCTTGCCT-3′, and mutant, 5′-GGGACCACCT-3′; BS2 wild type, 5′-GAGCATGGGG-3′, and mutant, 5′-GAGACCAGGG-3′) were generated using the QuikChange II XL site-directed mutagenesis kit (Stratagene). ARC mutants with the deletion of amino acids 10 to 30 (ARCΔ10-30), 31 to 50 (ARCΔ31-50), 51 to 70 (ARCΔ51-70), and 71 to 90 (ARCΔ71-90) and PUMA and Bad mutants without the BH3 domain were generated by PCR using the QuikChange II XL site-directed mutagenesis kit according to the manufacturer's instructions. All constructs were sequenced to check that only the desired mutations had been introduced. AdARC and Adp53 were constructed using the Adeno-X expression system (Clontech) according to the manufacturer's instructions. ARC antisense oligonucleotides were synthesized to inhibit endogenous ARC expression. The sequences of phosphothioate-modified antisense oligonucleotides targeted to ARC were as follows: ARC-AS, 5′-TGGGCATGGAGGGTCATAGCT-3′; S-ARC-AS, 5′-GTAGGCTGAGGTCGATCGGTA-3′; ARC-S, 5′-AGCTATGACCCTCCATGCCCA-3′. The specificity of the oligonucleotides was confirmed by comparison with all other sequences in GenBank using Nucleotide BLAST. There was no homology to other known rat DNA sequences. The p53 RNAi sense sequence was 5′-CACATGACTGAGGTCGTGA-3′; the antisense sequence was 5′-TCACGACCTCAGTCATGTG-3′. The scrambled p53 RNAi sense sequence was 5′-GACGTATGCAGAGTCGTCA-3′; the scrambled antisense sequence was 5′-TGACGACTCTGCATACGTC-3′. p53 RNAi-I sense sequence was 5′-CTTACCAAGGCAACTATGG-3′; the antisense sequence was 5′-CCATAGTTGCCTTGGTAAG-3′. The scrambled p53 RNAi-I sense sequence was 5′-ATGCAATCGGCTTAGCCAA-3′; the scrambled antisense sequence was 5′-TTGGCTAAGCCGATTGCAT-3′. They were cloned into the pSilencer Adeno 1.0-CMV vector (Ambion) according to the manufacturer's instructions. Adenovirus infection. All viruses were amplified in 293 cells. Cells were infected at the indicated multiplicity of infection (MOI) for 60 min. After washing with phosphate-buffered saline (PBS), culture medium was added and cells were cultured until the indicated time. Establishment of cells stably expressing ARC mutants. H9c2 cells seeded in a 12-well plate were transfected with ARC mutants, including ARCΔ10-30, ARCΔ31-50, ARCΔ51-70, and ARCΔ71-90 by using the Effectene transfection kit (Qiagen) according to the manufacturer's instructions. Transfected cells were selected in medium containing 1 mg/ml neomycin for 28 days. Cells stably expressing ARC mutants were confirmed with anti-ARC antibody (against the C terminus of ARC; Chemicon). Immunoblot analysis. Cells were lysed for 1 h at 4°C in a lysis buffer (20 mM Tris pH 7.5, 2 mM EDTA, 3 mM EGTA, 2 mM dithiothreitol [DTT], 250 mM sucrose, 0.1 mM phenylmethylsulfonyl fluoride, 1% Triton X-100) containing a protease inhibitor cocktail (Sigma, St. Louis, MO). Samples were subjected to 12% sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes. Equal protein loading was controlled by Ponceau Red staining of membranes. Blots were probed using primary antibodies. The anti-PUMA (1:200) and the anti-Bad (1:200) antibodies were from Santa Cruz Biotechnology. The anti-Bcl-2 antibody (1:500) was from BD Pharmingen. The anti-p53 monoclonal antibody (1:400) was from Calbiochem. The anti-ARC antibody (1:1,000) was from Chemicon. The rabbit immunoglobulin G control (1:200) was from Antigenix America Inc. After four washes with PBS-Tween 20, horseradish peroxidase-conjugated secondary antibodies were added. Antigen-antibody complexes were visualized by enhanced chemiluminescence. Preparation of mitochondrial fractions. Mitochondrial fractions were prepared as described elsewhere ( 33). Briefly, cells were washed twice with PBS, and the pellet was suspended in 0.2 ml of buffer A (20 mM HEPES pH 7.5, 10 mM KCl, 1.5 mM MgCl 2, 1 mM EGTA, 1 mM EDTA, 1 mM DTT, 0.1 mM phenylmethylsulfonyl fluoride, 250 mM sucrose) containing a protease inhibitor cocktail. The cells were homogenized by 12 strokes in a Dounce homogenizer. The homogenates were centrifuged twice at 750 × g for 5 min at 4°C. The supernatants were centrifuged at 10,000 × g for 15 min at 4°C to collect mitochondria-enriched heavy membranes. Immunoprecipitation and in vitro protein binding assay. Immunoprecipitation was conducted as described previously ( 34). The samples were precleared with 10% (vol/vol) protein A- or protein G-agarose (Roche) for 1 h on a rocking platform. Specific antibodies were added and rocked for 1 h. Immunoprecipitates were captured with 10% (vol/vol) protein A- or protein G-agarose for another hour. The agarose beads were spun down and washed three times with NET/NP-40 buffer (150 mM NaCl, 2 mM EDTA, 50 mM Tris-HCl pH 7.5, 0.1% NP-40). The antigens were released and denatured by adding SDS sample buffer. Immunoblot analysis was performed as described above. An in vitro protein binding assay was performed as described elsewhere ( 4, 44). In brief, recombinant ARC was produced as described previously ( 34). His-tagged PUMA or Bad in pcDNA3.1 was expressed in HEK293 cells and purified by using the ProBond purification system (Invitrogen). ARC (0.4 μg) was incubated with 0.4 μg of either PUMA or Bad in 50 μl of binding buffer (142 mM KCl, 5 mM MgCl 2, 10 mM HEPES [pH 7.4], 0.5 mM DTT, 1 mM EGTA, 0.1% NP-40, and a protease inhibitor cocktail) at 4°C for 2 h. Immunoprecipitation was performed as described above. ChIP analysis. Chromatin immunoprecipitation (ChIP) was performed as described elsewhere ( 56) with modifications. In brief, cells (0.5 × 10 8) were washed with PBS and incubated for 10 min with 1% formaldehyde at room temperature. The cross-linking was quenched with 0.1 M glycine for 5 min. Cells were washed twice with PBS and lysed for 1 h at 4°C in a lysis buffer. The cell lysates were sonicated into chromatin fragments with an average length of 500 to 800 bp as assessed by agarose gel electrophoresis. The samples were precleared with protein A-agarose (Roche) for 1 h at 4°C on a rocking platform, and 10 μg specific antibodies was added and rocked overnight at 4°C. Immunoprecipitates were captured with 10% (vol/vol) protein A-agarose for 4 h. Before use, protein A-agarose was blocked twice at 4°C with salmon sperm DNA (1 μg/ml) that had been sheared to a 500-bp length and bovine serum albumin (1 μg/ml) overnight. PCRs were performed with the primers that encompass p53 BS1 or BS2 of the rat ARC promoter. The oligonucleotides were as follows: BS1 (corresponding to a 183-bp fragment) forward, 5′-TCATAATAGGTAGGCAGTAGC, and reverse, 5′-CCTGTACCAAACCGTAGGAAC; BS2 (corresponding to a 182-bp fragment) forward, 5′-GAAGAATCCCGAGAGTATG, and reverse, 5′-CATACCTCCCTTCTGAACC. Luciferase assay. Cells were seeded in 12-well plates (6 × 104 cells/well). They were transfected with the plasmid constructs using the Effectene transfection kit (Qiagen). Each well contained 0.3 μg luciferase reporter plasmids, 5 ng SV-Renilla luciferase plasmids as the internal control. Cells were harvested at the indicated time after transfection for the detection of luciferase activity using the Dual Luciferase reporter assay kit (Promega) according to the manufacturer's instructions. Twenty μl of protein extracts was analyzed in a luminometer. Firefly luciferase activities were normalized to Renilla luciferase activity. Northern blot analysis and quantitative real-time PCR. Northern blot analysis was performed as described elsewhere ( 32). Prehybridization was conducted at 42°C for 4 h in prehybridization buffer: 50% formamide, 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 2% blocking reagent, 50 mM sodium phosphate, pH 7.4, 7% (wt/vol) SDS, and 0.1% (wt/vol) N-laurylsarkosine. Hybridization was performed in the same buffer and at the same temperature for 24 h with digoxigenin-labeled ARC or glyceraldehyde-3-phosphate dehydrogenase (GAPDH). For chemiluminescence detection, the membrane was blocked for 30 min in 2.5% blocking reagent. The membrane was then incubated for 30 min with antidigoxigenin antibody conjugated with alkaline phosphatase. After two washes with 100 mM maleic acid buffer containing 0.3% Tween 20, CSPD substrate solution was added to the membrane and incubated for 10 min. For quantitative real-time PCR, RNA was prepared with TRIzol reagent (Invitrogen). Total RNA was processed to cDNA by reverse transcription using the high-capacity cDNA reverse transcription kit (Applied Biosystems). Real-time PCR using Power SYBR Green PCR master mix (Applied Biosystems) was carried out in triplicate in a 7500 Fast real-time PCR system (Applied Biosystems) according to the manufacturer's instructions. The sequences of ARC primers were as follows: forward, 5′-CGGAAACGGCTGGTAGAAAC-3′; reverse, 5′-TGGCATGCTCACAGTTTGCT-3′. Analysis was performed using the software supplied with the instrument. Primers for GAPDH were as follows: forward primer, 5′-TGTTCCAGTATGACTCTACC-3′; reverse primer, 5′-TGGGTTTCCCGTTGATGACC-3′. The specificity of the PCR amplification was confirmed by agarose gel electrophoresis. Detection of caspase 8 activity. Caspase 8 activity was detected using an assay kit (R&D Systems). The assay procedures were according to the kit instructions. Statistical analysis. Paired data were evaluated by Student's t test. A one-way analysis of variance was used for multiple comparisons. A P value of <0.05 was considered significant. |
RESULTS ARC down-regulation and p53 up-regulation simultaneously occur upon stimulation with hydrogen peroxide or anoxia. Reactive oxygen species (such as hydrogen peroxide) and anoxia play an important role in the development of apoptosis-related cardiac diseases, including myocardial infarction and heart failure ( 17). To understand the role of ARC and p53 in regulating cell death induced by hydrogen peroxide and anoxia, we analyzed their expression levels. ARC protein levels were down-regulated whereas p53 protein levels were up-regulated upon hydrogen peroxide treatment (Fig. 1A). A similar result was observed in cells exposed to anoxia (Fig. 1B). We determined whether ARC is able to influence the cell fate upon stimulation with hydrogen peroxide or anoxia. ARC could prevent cell death induced by hydrogen peroxide (Fig. 1C) and anoxia (Fig. 1D). These data indicate that both hydrogen peroxide and anoxia are able to induce ARC down-regulation and p53 up-regulation, and the modulation of ARC levels can alter the cell fate upon treatment with hydrogen peroxide or anoxia.  | FIG. 1.Hydrogen peroxide and anoxia induce a decrease in ARC levels and an elevation in p53 levels. (A and B) H2O2 and anoxia induce p53 up-regulation and ARC down-regulation. H9c2 cells were treated with 0.1 mM H2O2 (A) or exposed to anoxic conditions (B). (more ...) |
p53 can negatively regulate ARC expression levels. To understand whether there is a link between p53 up-regulation and ARC down-regulation, we first detected whether inhibition of endogenous p53 can influence ARC protein levels. Inhibition of p53 was achieved by using RNA interference (RNAi) (p53RNAi). Scrambled p53RNAi (p53-S-RNAi) was used as the control. p53RNAi but not p53-S-RNAi could attenuate the decrease in ARC protein levels in response to stimulation with hydrogen peroxide (Fig. 2A) or anoxia (Fig. 2B). We next detected whether ARC mRNA levels also could be altered by modulating p53. Hydrogen peroxide (Fig. 2C) and anoxia (Fig. 2D) led to a decrease in ARC mRNA levels, revealed by quantitative real-time PCR and Northern blotting. p53RNAi but not p53-S-RNAi could block the decrease in ARC mRNA levels. Thus, it appears that p53 can negatively regulate ARC at both the protein and mRNA levels.  | FIG. 2.p53 negatively regulates ARC expression at the protein and mRNA levels. (A) Inhibition of endogenous p53 attenuates the decrease in ARC protein levels induced by H2O2. H9c2 cells were infected with the adenoviral vector harboring p53RNAi (Adp53RNAi) or (more ...) |
ARC and p53 are functionally related. To ask whether there is a functional impact between ARC and p53 in cell death, we first detected whether p53 participates in conveying the death signals of hydrogen peroxide and anoxia. p53RNAi but not p53-S-RNAi could attenuate cell death induced by hydrogen peroxide (Fig. 3A) or anoxia (Fig. 3B), indicating that cell death occurred in a p53-dependent manner. We next detected whether ARC influences p53-induced cell death. In the enforced expression model, p53 could induce a decrease in ARC protein levels. Expression of exogenous ARC could compensate the reduction of ARC levels caused by p53. Concomitantly, ARC could prevent p53-induced cell death (Fig. 3C).  | FIG. 3.ARC and p53 are functionally related. (A) Inhibition of p53 attenuates H2O2-induced cell death. Cells were infected with Adp53RNAi or Adp53-S-RNAi at an MOI of 50. At 24 h after infection, cells were treated with H2O2. Cell death was detected 24 h after (more ...) |
Further, we detected the susceptibility of cells to death when endogenous ARC expression is inhibited. We employed antisense oligonucleotides to inhibit endogenous ARC. Pretreatment with ARC antisense oligonucleotides (ARC-AS) but not ARC sense oligonucleotides (ARC-S) and scrambled ARC antisense oligonucleotides (S-ARC-AS) caused the cells to be more susceptible to death upon hydrogen peroxide treatment (Fig. 3D). We finally tested whether it is p53 that mediates the cell death in the absence of ARC. Knockdown of p53 led to a reduction in the percentage of cell death upon hydrogen peroxide treatment (Fig. 3E). Taken together, these data indicate that ARC and p53 are functionally related. p53 transcriptionally regulates ARC. p53 is a transcriptional factor, and the parallel alterations in p53 and ARC expression levels led us to consider whether ARC is a transcriptional target of p53. We first analyzed the consensus binding sites in the promoter region of rat ARC according to the reported consensus binding site of p53, PuPuPuC(A/T)(T/A)GPyPyPy(N) 0-14PuPuPuC(A/T)(T/A)GPyPyPy, where N stands for any nucleotide ( 9). The ARC promoter region contains one optimal p53 binding site (p53 BS1, −811 to −787, GGGCTTGCCTAGCAAACGCAAGGCC) and one suboptimal binding site (p53 BS2, −397 to −378, GAGCATGGGGTGCCTTGGCA) (Fig. 4A).  | FIG. 4.p53 negatively regulates ARC promoter activity. (A) Potential p53 binding sites in the 5′-flanking sequence of the rat ARC gene. The 5′-flanking sequence of ARC contains two potential p53 DNA binding sites (indicated as BS1 and BS2). The (more ...) |
We next tested whether p53 can influence ARC promoter activity. The wild-type ARC promoter activity was dramatically suppressed by p53 but not by the negative control, β-galactosidase. The introduction of mutations in p53 BS1 but not p53 BS2 resulted in the disability of p53 to repress the promoter activity, indicating that BS1 was the binding site of p53 (Fig. 4B). We also tested whether hydrogen peroxide treatment influences ARC promoter activity. A decrease in the promoter activities of wild-type ARC and the BS2 mutant, but not the BS1 mutant, was observed in cells treated with hydrogen peroxide (Fig. 4C). Subsequently, we asked whether p53 is responsible for the alterations of ARC promoter activity upon hydrogen peroxide treatment. p53RNAi but not its scrambled form could block the decrease in ARC promoter activity upon hydrogen peroxide treatment (Fig. 4D). These data indicate that p53 can influence ARC promoter activity. A ChIP assay was employed to detect whether p53 can associate with the ARC promoter in vivo. The results showed that p53 bound to the ARC promoter region encompassing BS1 upon hydrogen peroxide treatment (Fig. 4E, upper panel). However, an association was not detectable in the ARC promoter region encompassing BS2 upon hydrogen peroxide treatment (Fig. 4E, lower panel). To further characterize whether ARC repression by p53 occurs in a direct manner, we employed primary rat cardiomyocytes, which lose their ability to proliferate, withdraw from the cell cycle, and express a high level of ARC but an extremely low level of p53 ( 29, 38, 50, 57). p53 induced a decrease in ARC protein levels in the primary rat cardiomyocytes (Fig. 4F). In addition, the temperature-sensitive p53(Val135) in the presence of cycloheximide still induced a significant decrease in ARC mRNA levels (Fig. 4G), indicating that ARC is a primary target of p53. From these findings together, it appears that p53 can negatively control the transcriptional activity of ARC. ARC binds to PUMA or Bad, displacing their associations with Bcl-2. In the following experiments we explored the molecular mechanisms by which ARC antagonizes p53-induced cell death. p53 can induce cell death through the transcription-dependent pathway. PUMA and Bad are the transcriptional targets of p53 ( 24, 37, 45, 63). We first detected the expression levels of PUMA and Bad upon treatment with hydrogen peroxide and anoxia. Both hydrogen peroxide (Fig. 5A) and anoxia (Fig. 5B) led to the up-regulation of PUMA and Bad blocked by p53RNAi but not p53-S-RNAi.  | FIG. 5.ARC binds to PUMA and Bad, displacing their associations with Bcl-2. (A) PUMA and Bad are up-regulated in response to H2O2 treatment. Cells were infected with Adp53RNAi or Adp53-S-RNAi at an MOI of 50. At 24 h after infection, they were treated with 0.1 (more ...) |
We next determined whether there is an association between ARC and PUMA or Bad. The associations of ARC with PUMA or Bad in cells without treatment were barely detectable (Fig. 5C, first lane, middle panel), and this can be explained by the low levels of PUMA and Bad in cells without treatment. The associations of endogenous ARC with PUMA or Bad were weak in cells treated with hydrogen peroxide or anoxia (data not shown), and this could be due to the down-regulation of endogenous ARC, as shown in Fig. 1. In contrast, the associations of ARC with PUMA or Bad could be detected in cells expressing exogenous ARC and exposed to hydrogen peroxide or anoxia (Fig. 5C). To test whether ARC can directly bind to PUMA or Bad, we analyzed whether ARC is able to bind to PUMA or Bad in vitro. The in vitro binding assay revealed that ARC could associate with PUMA (Fig. 5D, upper panel) or Bad (Fig. 5D, lower panel). To test whether stress can influence the binding of ARC to PUMA or Bad, we employed a model in which ARC and PUMA or Bad were simultaneously expressed. To exclude the influence of endogenous ARC, HEK293 cells were used to coexpress ARC and PUMA or Bad, because endogenous ARC expression in this cell line is undetectable ( 34, 46). The results showed that the binding of ARC to PUMA or Bad could occur in the presence or absence of stress (Fig. 5E). Taken together, these results suggest that ARC can bind to PUMA or Bad. Further, we analyzed the associations of Bcl-2 with PUMA or Bad in the presence or absence of ARC. The associations of Bcl-2 with PUMA or Bad could be observed in cells exposed to hydrogen peroxide or anoxia. However, their associations disappeared in the presence of ARC. ARC could not influence the expression levels of PUMA, Bad, and Bcl-2 (Fig. 5F). These data indicate that ARC can prevent the associations of PUMA or Bad with Bcl-2. Characterization of the binding sites between ARC and PUMA or Bad. To further confirm the association of ARC with PUMA or Bad, we analyzed the binding sites between ARC and PUMA or Bad. The binding of ARC to caspase 8 is through its CARD ( 29). We tested whether the CARD is responsible for ARC associations with PUMA or Bad. The binding abilities of ARC mutants to endogenous PUMA or Bad were analyzed. As shown in Fig. 6A, ARCΔ10-30 and ARCΔ71-90 but not ARCΔ31-50 or ARCΔ51-70 were able to bind to PUMA and Bad upon hydrogen peroxide treatment, indicating that amino acids 31 to 70 are responsible for the binding ability of ARC to PUMA or Bad.  | FIG. 6.Analysis of the binding sites between ARC and PUMA or Bad. (A) Analysis of the binding sites of ARC to PUMA and Bad. H9c2 cells stably expressing ARC mutants were treated with 0.1 mM H2O2. The protein levels of PUMA, Bad, and ARC were analyzed by immunoblotting (more ...) |
To test whether such an association plays a functional role, we analyzed the ability of these mutants to inhibit cell death. ARCΔ10-30 and ARCΔ71-90 but not ARCΔ31-50 and ARCΔ51-70 retained the ability to antagonize cell death induced by hydrogen peroxide (Fig. 6A). We finally analyzed the binding sites of PUMA and Bad to ARC. The BH3 domains of PUMA and Bad have been shown to be essential for their interactions with other proteins, such as Bcl-2 ( 27, 63). We tested whether the BH3 domain is necessary for PUMA or Bad to interact with ARC. Deletion of the BH3 domain in PUMA (Fig. 6B) or Bad (Fig. 6C) led to their inabilities to interact with ARC, suggesting that the BH3 domain is necessary for their associations with ARC. The association of PUMA with ARC leads to caspase 8 activation. ARC under physiological conditions is associated with caspase 8 ( 34). PUMA could bind to ARC, as shown in Fig. 5C. We asked whether PUMA can influence the association of ARC with caspase 8. The association of ARC with caspase 8 was detectable in the control cells without treatment or expressing β-galactosidase. However, their association levels were decreased in cells expressing PUMA. Enforced expression of ARC restored their association levels (Fig. 7A). Concomitantly, caspase 8 activation (Fig. 7B) and cell death (Fig. 7C) were observed in the presence of PUMA. ARC attenuated caspase 8 activation and cell death induced by PUMA. These results suggest that PUMA can influence the interaction of ARC with caspase 8.  | FIG. 7.PUMA binds to ARC, resulting in activation of caspase 8. (A) The association levels of ARC with caspase 8 are reduced in the presence PUMA. H9c2 cells were infected with AdPUMA, Adβ-Gal, or AdARC at an MOI of 80. At 24 h after infection, cells (more ...) |
ARC repression by p53 is involved in the death program with daunomycin. Chemotherapy agents can induce cardiomyocyte apoptosis, leading to heart failure ( 53, 62). To understand whether ARC repression by p53 is involved in apoptosis induced by chemotherapy agents, we first tested whether ARC expression levels can be altered in response to daunomycin treatment. As shown in Fig. 8A, the expression levels of p53 were up-regulated, whereas the expression levels of ARC were decreased upon daunomycin treatment. We next tested whether p53 is responsible for ARC down-regulation. Two p53 RNAi constructs were employed to inhibit p53. p53-RNAi and p53-RNAi-I but not their scrambled forms could inhibit p53 expression and attenuate the reduction of ARC expression levels (Fig. 8B, upper panels). Concomitantly, they could block daunomycin-induced cell death (Fig. 8B, lower panel). Enforced expression of ARC could prevent cell death induced by daunomycin (Fig. 8C). We finally tested whether ARC could bind to PUMA upon daunomycin treatment. The association of ARC with PUMA was observed in cells treated with daunomycin (Fig. 8D). Taken together, these results suggest that ARC repression by p53 may contribute to daunomycin-induced cell death.  | FIG. 8.p53 is responsible for ARC down-regulation in response to daunomycin treatment. (A) ARC expression levels were reduced upon daunomycin treatment. The primary rat cardiomyocytes were treated with 1 μM daunomycin. Cells were harvested at the indicated (more ...) |
|
REFERENCES 1. Barlucchi, L., A. Leri, D. E. Dostal, F. Fiordaliso, H. Tada, T. H. Hintze, J. Kajstura, B. Nadal-Ginard, and P. Anversa. 2001. Canine ventricular myocytes possess a renin-angiotensin system that is upregulated with heart failure. Circ. Res. 88:298-304. [PubMed]. 2. Bennett, M., K. Macdonald, S. W. Chan, J. P. Luzio, R. Simari, and P. Weissberg. 1998. Cell surface trafficking of Fas: a rapid mechanism of p53-mediated apoptosis. Science 282:290-293. [PubMed]. 3. Bialik, S., D. L. Geenen, I. E. Sasson, R. Cheng, J. W. Horner, S. M. Evans, E. M. Lord, C. J. Koch, and R. N. Kitsis. 1997. Myocyte apoptosis during acute myocardial infarction in the mouse localizes to hypoxic regions but occurs independently of p53. J. Clin. Investig. 100:1363-1372. [PubMed]. 4. Cartron, P. F., T. Gallenne, G. Bougras, F. Gautier, F. Manero, P. Vusio, K. Meflah, F. M. Vallette, and P. Juin. 2004. The first alpha helix of Bax plays a necessary role in its ligand-induced activation by the BH3-only proteins Bid and PUMA. Mol. Cell 16:807-818. [PubMed]. 5. Crow, M. T., K. Mani, Y. J. Nam, and R. N. Kitsis. 2004. The mitochondrial death pathway and cardiac myocyte apoptosis. Circ. Res. 95:957-970. [PubMed]. 6. Donath, S., P. F. Li, C. Willenbockel, N. Al-Saadi, V. Gross, T. Willnow, M. Bader, U. Martin, J. Bauersachs, K. C. Wollert, D. Dietz, and R. von Harsdorf. 2006. Apoptosis repressor with caspase recruitment domain is required for cardioprotection in response to biomechanical and ischemic stress. Circulation 113:1203-1212. [PubMed]. 7. D'Souza, S., H. Xin, S. Walter, and D. Choubey. 2001. The gene encoding p202, an interferon-inducible negative regulator of the p53 tumor suppressor, is a target of p53-mediated transcriptional repression. J. Biol. Chem. 276:298-305. [PubMed]. 8. Ekhterae, D., Z. Lin, M. S. Lundberg, M. T. Crow, F. C. R. Brosius, and G. Nunez. 1999. ARC inhibits cytochrome c release from mitochondria and protects against hypoxia-induced apoptosis in heart-derived H9c2 cells. Circ. Res. 85:e70-e77. [PubMed]. 9. el-Deiry, W. S., S. E. Kern, J. A. Pietenpol, K. W. Kinzler, and B. Vogelstein. 1992. Definition of a consensus binding site for p53. Nat. Genet. 1:45-49. [PubMed]. 10. Faraonio, R., P. Vergara, D. Di Marzo, M. G. Pierantoni, M. Napolitano, T. Russo, and F. Cimino. 2006. p53 suppresses the Nrf2-dependent transcription of antioxidant response genes. J. Biol. Chem. 281:39776-39784. [PubMed]. 11. Farrow, S. N., J. H. White, I. Martinou, T. Raven, K. T. Pun, C. J. Grinham, J. C. Martinou, and R. Brown. 1995. Cloning of a bcl-2 homologue by interaction with adenovirus E1B 19K. Nature 374:731-733. [PubMed]. 12. Field, L. J. 2004. Modulation of the cardiomyocyte cell cycle in genetically altered animals. Ann. N. Y. Acad. Sci. 1015:160-170. [PubMed]. 13. Fisher, S. A., B. L. Langille, and D. Srivastava. 2000. Apoptosis during cardiovascular development. Circ. Res. 87:856-864. [PubMed]. 14. Foo, R. S., L. K. Chan, R. N. Kitsis, and M. R. Bennett. 2007. Ubiquitination and degradation of the anti-apoptotic protein ARC by MDM2. J. Biol. Chem. 282:5529-5535. [PubMed]. 15. Foo, R. S., K. Mani, and R. N. Kitsis. 2005. Death begets failure in the heart. J. Clin. Investig. 115:565-571. [PubMed]. 16. Geertman, R., A. McMahon, and E. L. Sabban. 1996. Cloning and characterization of cDNAs for novel proteins with glutamic acid-proline dipeptide tandem repeats. Biochim. Biophys. Acta 1306:147-152. [PubMed]. 17. Giordano, F. J. 2005. Oxygen, oxidative stress, hypoxia, and heart failure. J. Clin. Investig. 115:500-508. [PubMed]. 18. Gottifredi, V., O. Karni-Schmidt, S.-Y. Shieh, and C. Prives. 2001. p53 down-regulates CHK1 through p21 and the retinoblastoma protein. Mol. Cell. Biol. 21:1066-1076. [PubMed]. 19. Green, D. R., and J. E. Chipuk. 2006. p53 and metabolism: inside the TIGAR. Cell 126:30-32. [PubMed]. 20. Gustafsson, A. B., J. G. Tsai, S. E. Logue, M. T. Crow, and R. A. Gottlieb. 2004. Apoptosis repressor with caspase recruitment domain protects against cell death by interfering with Bax activation. J. Biol. Chem. 279:21233-21238. [PubMed]. 21. Hayakawa, Y., M. Chandra, W. Miao, J. Shirani, J. H. Brown, G. W. Dorn II, R. C. Armstrong, and R. N. Kitsis. 2003. Inhibition of cardiac myocyte apoptosis improves cardiac function and abolishes mortality in the peripartum cardiomyopathy of Gαq transgenic mice. Circulation 108:3036-3041. [PubMed]. 22. Hoffman, W. H., S. Biade, J. T. Zilfou, J. Chen, and M. Murphy. 2002. Transcriptional repression of the anti-apoptotic survivin gene by wild type p53. J. Biol. Chem. 277:3247-3257. [PubMed]. 23. Itoh, N., S. Yonehara, A. Ishii, M. Yonehara, S. Mizushima, M. Sameshima, A. Hase, Y. Seto, and S. Nagata. 1991. The polypeptide encoded by the cDNA for human cell surface antigen Fas can mediate apoptosis. Cell 66:233-243. [PubMed]. 24. Jiang, P., W. Du, K. Heese, and M. Wu. 2006. The Bad guy cooperates with good cop p53: Bad is transcriptionally up-regulated by p53 and forms a Bad/p53 complex at the mitochondria to induce apoptosis. Mol. Cell. Biol. 26:9071-9082. [PubMed]. 25. Kang, P. M., and S. Izumo. 2000. Apoptosis and heart failure: a critical review of the literature. Circ. Res. 86:1107-1113. [PubMed]. 26. Kannan, K., N. Amariglio, G. Rechavi, J. Jakob-Hirsch, I. Kela, N. Kaminski, G. Getz, E. Domany, and D. Givol. 2001. DNA microarrays identification of primary and secondary target genes regulated by p53. Oncogene 20:2225-2234. [PubMed]. 27. Kelekar, A., B. S. Chang, J. E. Harlan, S. W. Fesik, and C. B. Thompson. 1997. Bad is a BH3 domain-containing protein that forms an inactivating dimer with Bcl-X L. Mol. Cell. Biol. 17:7040-7046. [PubMed]. 28. Kitsis, R. N., and D. L. Mann. 2005. Apoptosis and the heart: a decade of progress. J. Mol. Cell. Cardiol. 38:1-2. [PubMed]. 29. Koseki, T., N. Inohara, S. Chen, and G. Nunez. 1998. ARC, an inhibitor of apoptosis expressed in skeletal muscle and heart that interacts selectively with caspases. Proc. Natl. Acad. Sci. USA 95:5156-5160. [PubMed]. 30. Leri, A., Y. Liu, X. Wang, J. Kajstura, A. Malhotra, L. G. Meggs, and P. Anversa. 1999. Overexpression of insulin-like growth factor-1 attenuates the myocyte renin-angiotensin system in transgenic mice. Circ. Res. 84:752-762. [PubMed]. 31. Levine, A. J., W. Hu, and Z. Feng. 2006. The p53 pathway: what questions remain to be explored? Cell Death Differ. 13:1027-1036. [PubMed]. 32. Li, P. F., R. Dietz, and R. von Harsdorf. 1997. Differential effect of hydrogen peroxide and superoxide anion on apoptosis and proliferation of vascular smooth muscle cells. Circulation 96:3602-3609. [PubMed]. 33. Li, P. F., R. Dietz, and R. von Harsdorf. 1999. p53 regulates mitochondrial membrane potential through reactive oxygen species and induces cytochrome c-independent apoptosis blocked by Bcl-2. EMBO J. 18:6027-6036. [PubMed]. 34. Li, P. F., J. Li, E. C. Muller, A. Otto, R. Dietz, and R. von Harsdorf. 2002. Phosphorylation by protein kinase CK2: a signaling switch for the caspase-inhibiting protein ARC. Mol. Cell 10:247-258. [PubMed]. 35. Long, X., M. O. Boluyt, M. L. Hipolito, M. S. Lundberg, J. S. Zheng, L. O'Neill, C. Cirielli, E. G. Lakatta, and M. T. Crow. 1997. p53 and the hypoxia-induced apoptosis of cultured neonatal rat cardiac myocytes. J. Clin. Investig. 99:2635-2643. [PubMed]. 36. Long, X., M. T. Crow, S. J. Sollott, L. O'Neill, D. S. Menees, M. de Lourdes Hipolito, M. O. Boluyt, T. Asai, and E. G. Lakatta. 1998. Enhanced expression of p53 and apoptosis induced by blockade of the vacuolar proton ATPase in cardiomyocytes. J. Clin. Investig. 101:1453-1461. [PubMed]. 37. Maclean, K. H., U. B. Keller, C. Rodriguez-Galindo, J. A. Nilsson, and J. L. Cleveland. 2003. c-Myc augments gamma irradiation-induced apoptosis by suppressing Bcl-X L. Mol. Cell. Biol. 23:7256-7270. [PubMed]. 38. MacLellan, W. R., and M. D. Schneider. 2000. Genetic dissection of cardiac growth control pathways. Annu. Rev. Physiol. 62:289-319. [PubMed]. 39. Marchenko, N. D., A. Zaika, and U. M. Moll. 2000. Death signal-induced localization of p53 protein to mitochondria. A potential role in apoptotic signaling. J. Biol. Chem. 275:16202-16212. [PubMed]. 40. Mehrhof, F. B., F. U. Muller, M. W. Bergmann, P. Li, Y. Wang, W. Schmitz, R. Dietz, and R. von Harsdorf. 2001. In cardiomyocyte hypoxia, insulin-like growth factor-I-induced antiapoptotic signaling requires phosphatidylinositol-3-OH-kinase-dependent and mitogen-activated protein kinase-dependent activation of the transcription factor cAMP response element-binding protein. Circulation 104:2088-2094. [PubMed]. 41. Mercier, I., M. Vuolo, R. Madan, X. Xue, A. J. Levalley, A. W. Ashton, J. F. Jasmin, M. T. Czaja, E. Y. Lin, R. C. Armstrong, J. W. Pollard, and R. N. Kitsis. 2005. ARC, an apoptosis suppressor limited to terminally differentiated cells, is induced in human breast cancer and confers chemo- and radiation-resistance. Cell Death Differ. 12:682-686. [PubMed]. 42. Mihara, M., S. Erster, A. Zaika, O. Petrenko, T. Chittenden, P. Pancoska, and U. M. Moll. 2003. p53 has a direct apoptogenic role at the mitochondria. Mol. Cell 11:577-590. [PubMed]. 43. Miyashita, T., and J. C. Reed. 1995. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 80:293-299. [PubMed]. 44. Moreau, C., P.-F. Cartron, A. Hunt, K. Meflah, D. R. Green, G. Evan, F. M. Vallette, and P. Juin. 2003. Minimal BH3 peptides promote cell death by antagonizing anti-apoptotic proteins. J. Biol. Chem. 278:19426-19435. [PubMed]. 45. Nakano, K., and K. H. Vousden. 2001. PUMA, a novel proapoptotic gene, is induced by p53. Mol. Cell 7:683-694. [PubMed]. 46. Nam, Y. J., K. Mani, A. W. Ashton, C. F. Peng, B. Krishnamurthy, Y. Hayakawa, P. Lee, S. J. Korsmeyer, and R. N. Kitsis. 2004. Inhibition of both the extrinsic and intrinsic death pathways through nonhomotypic death-fold interactions. Mol. Cell 15:901-912. [PubMed]. 47. Nam, Y. J., K. Mani, L. Wu, C. F. Peng, J. W. Calvert, R. S. Foo, B. Krishnamurthy, W. Miao, A. W. Ashton, D. J. Lefer, and R. N. Kitsis. 2007. The apoptosis inhibitor ARC undergoes ubiquitin-proteasomal-mediated degradation in response to death stimuli: identification of a degradation-resistant mutant. J. Biol. Chem. 282:5522-5528. [PubMed]. 48. Neuss, M., R. Monticone, M. S. Lundberg, A. T. Chesley, E. Fleck, and M. T. Crow. 2001. The apoptotic regulatory protein ARC (apoptosis repressor with caspase recruitment domain) prevents oxidant stress-mediated cell death by preserving mitochondrial function. J. Biol. Chem. 276:33915-33922. [PubMed]. 49. Oda, K., H. Arakawa, T. Tanaka, K. Matsuda, C. Tanikawa, T. Mori, H. Nishimori, K. Tamai, T. Tokino, Y. Nakamura, and Y. Taya. 2000. p53AIP1, a potential mediator of p53-dependent apoptosis, and its regulation by Ser-46-phosphorylated p53. Cell 102:849-862. [PubMed]. 50. Olson, E. N., and M. D. Schneider. 2003. Sizing up the heart: development redux in disease. Genes Dev. 17:1937-1956. [PubMed]. 51. Poelmann, R. E., D. Molin, L. J. Wisse, and A. C. Gittenberger-de Groot. 2000. Apoptosis in cardiac development. Cell Tissue Res. 301:43-52. [PubMed]. 52. Polyak, K., Y. Xia, J. L. Zweier, K. W. Kinzler, and B. Vogelstein. 1997. A model for p53-induced apoptosis. Nature 389:300-305. [PubMed]. 53. Sawyer, D. B., R. Fukazawa, M. A. Arstall, and R. A. Kelly. 1999. Daunorubicin-induced apoptosis in rat cardiac myocytes is inhibited by dexrazoxane. Circ. Res. 84:257-265. [PubMed]. 54. Sayan, B. S., A. E. Sayan, R. A. Knight, G. Melino, and G. M. Cohen. 2006. p53 is cleaved by caspases generating fragments localizing to mitochondria. J. Biol. Chem. 281:13566-13573. [PubMed]. 55. Srinivasula, S. M., T. Fernandes-Alnemri, J. Zangrilli, N. Robertson, R. C. Armstrong, L. Wang, J. A. Trapani, K. J. Tomaselli, G. Litwack, and E. S. Alnemri. 1996. The Ced-3/interleukin 1β converting enzyme-like homolog Mch6 and the lamin-cleaving enzyme Mch2α are substrates for the apoptotic mediator CPP32. J. Biol. Chem. 271:27099-27106. [PubMed]. 56. Szak, S. T., D. Mays, and J. A. Pietenpol. 2001. Kinetics of p53 binding to promoter sites in vivo. Mol. Cell. Biol. 21:3375-3386. [PubMed]. 57. von Harsdorf, R., P. F. Li, and R. Dietz. 1999. Signaling pathways in reactive oxygen species-induced cardiomyocyte apoptosis. Circulation 99:2934-2941. [PubMed]. 58. Vousden, K. H., and C. Prives. 2005. p53 and prognosis: new insights and further complexity. Cell 120:7-10. [PubMed]. 59. Wang, M., S. Qanungo, M. T. Crow, M. Watanabe, and A. L. Nieminen. 2005. Apoptosis repressor with caspase recruitment domain (ARC) is expressed in cancer cells and localizes to nuclei. FEBS Lett. 579:2411-2415. [PubMed]. 60. Watanabe-Fukunaga, R., C. I. Brannan, N. Itoh, S. Yonehara, N. G. Copeland, N. A. Jenkins, and S. Nagata. 1992. The cDNA structure, expression, and chromosomal assignment of the mouse Fas antigen. J. Immunol. 148:1274-1279. [PubMed]. 61. Webster, K. A., D. J. Discher, S. Kaiser, O. Hernandez, B. Sato, and N. H. Bishopric. 1999. Hypoxia-activated apoptosis of cardiac myocytes requires reoxygenation or a pH shift and is independent of p53. J. Clin. Investig. 104:239-252. [PubMed]. 62. Yeh, E. T., A. T. Tong, D. J. Lenihan, S. W. Yusuf, J. Swafford, C. Champion, J. B. Durand, H. Gibbs, A. A. Zafarmand, and M. S. Ewer. 2004. Cardiovascular complications of cancer therapy: diagnosis, pathogenesis, and management. Circulation 109:3122-3131. [PubMed]. 63. Yu, J., L. Zhang, P. M. Hwang, K. W. Kinzler, and B. Vogelstein. 2001. PUMA induces the rapid apoptosis of colorectal cancer cells. Mol. Cell 7:673-682. [PubMed]. |
![[down-pointing small open triangle]](corehtml/pmc/pmcents/x25BF.gif)
This article has been 
