Join Evaluation Legend

Serious alignment problem, requires review. (details...)
- Zero, or more than one, overlaps
- Half dove-tail >50 bp
- Alignment identity <98%
- Alignment length <100 bp
- >2 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Minor alignment problem. (details...)
- Exactly one overlap
- Half dove-tail >0 bp and <=50bp
- Alignment identity <99.1%
- Alignment length <2000 bp
- >0 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Excellent alignment, meets all defined criteria. (details...)
- Exactly one RuleInfo
- Half dove-tail <=0 bp
- Alignment identity >=99.1%
- Alignment length >=2000 bp
- <=0 gaps, each gap >25 bp, not marked as an SSR
- <=0 gaps, each gap >50 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, marked as an SSR
Certificate submitted, not yet approved.
Certificate submitted and approved.
Valid, contained clone
Join not evaluated due to one accession not being finished.

Curator Links

Add/Update certificate

Alignment for AL732548.9 and AL732594.5

AL732548.9 Mouse DNA sequence from clone RP24-145P21 on chromosome 4 Contains the Cdc26 gene for cell division cycle 26, the Slc31a1 gene for solute carrier family 31 member 1, the 5' end of a novel gene and a CpG island, complete sequence [htgs_phase3]

Length: 100,074 bp

AL732594.5 Mouse DNA sequence from clone RP24-189G18 on chromosome 4, complete sequence [htgs_phase3]

Length: 145,776 bp

Alignment Summary

Join evaluation: green

Alignment count: 1

Go to Endhit Table

Alignment 1
Align ID: 87
Total Length: 2000
Aligned Length: 2000
Percent Identity: 100
Number of Gaps: 0
Number of Mismatches: 0
Source: CtgOverlap Seq-Align
Valid Switchpoint: true (A)

Alignment 1 of 1

 Mismatches = 0, Gaps = 0, Length = 2000
 Percent identity = 100%
 Score = 3965 bits (2000), Expect = 0
  3 BAC and 4 Fosmid bridging clones.
  3 BAC and 4 Fosmid concordant clones.
  0 BAC and 0 Fosmid discordant clones.

AL732548.9 >98075   gatctggcgccctcttctggagtgtctgaagacagctagtgtacttacatataataaata 98134  
AL732594.5 >1       ............................................................ 60     

AL732548.9 >98135   atttaaaaaaaaaaaaaaaaacaaagttacacttagaccactaaaataaaaagctaaatg 98194  
AL732594.5 >61      ............................................................ 120    

AL732548.9 >98195   atagtgatctacatgaaagttttgctatagtgtgcattcatagaaattattattgcgtgc 98254  
AL732594.5 >121     ............................................................ 180    

AL732548.9 >98255   atccagaacgaaacaaaacactacaatgtataggaaacatttacacttctctcaggaggc 98314  
AL732594.5 >181     ............................................................ 240    

AL732548.9 >98315   ttagcacagcaaggggtgatctaatcaaaacactggcccgtgacatttcaaaactgcttt 98374  
AL732594.5 >241     ............................................................ 300    

AL732548.9 >98375   attctatcagatactactttctaccagatccttacgtagagaaatggaagtcagctccaa 98434  
AL732594.5 >301     ............................................................ 360    

AL732548.9 >98435   gggggaaaggaagaaacacttagaaaaacaacaacaacaacaataattccctacttgcga 98494  
AL732594.5 >361     ............................................................ 420    

AL732548.9 >98495   gggaactttctgaaagcctcaccactagagagcaataatgagtacgagttaaaagcgcgg 98554  
AL732594.5 >421     ............................................................ 480    

AL732548.9 >98555   ctcggcggctcgcgacctgccacgttactaattctactactacggctccagaacgacctt 98614  
AL732594.5 >481     ............................................................ 540    

AL732548.9 >98615   ttctcaccagaatgttttttggtttttttcgggcttgtactcttgtccgtgactgagatg 98674  
AL732594.5 >541     ............................................................ 600    

AL732548.9 >98675   actaaaacagaataagctcgttgcgcgtaactcggcattagtaagtcctcgaaaaggaag 98734  
AL732594.5 >601     ............................................................ 660    

AL732548.9 >98735   tgctcttctaattggagttgttcggggcagggccttgagtgtggaagtgagtctgttcag 98794  
AL732594.5 >661     ............................................................ 720    

AL732548.9 >98795   ctcggcaaacgcgcatatttttgtaacccccacaactttcatgtaaggatttttttttta 98854  
AL732594.5 >721     ............................................................ 780    

AL732548.9 >98855   aaaaaaaccttatctctgatggcctaacattcattggagctactactgctgatatgctct 98914  
AL732594.5 >781     ............................................................ 840    

AL732548.9 >98915   ttatctggagccttcatggaccctttatttcaaagaacacagacaaagaataggctgtag 98974  
AL732594.5 >841     ............................................................ 900    

AL732548.9 >98975   acaagtaaacccacaacaaactaggccgcagctcctccaccacatctctattttagcctt 99034  
AL732594.5 >901     ............................................................ 960    

AL732548.9 >99035   agaaggtcttagagtttaatatcttcttgaagcccaaactgattacgtagccaccgagtt 99094  
AL732594.5 >961     ............................................................ 1020   

AL732548.9 >99095   acgaggggcccccgaaggacttccgtcgtggacaacagtcctctttcccagctccaaggc 99154  
AL732594.5 >1021    ............................................................ 1080   

AL732548.9 >99155   tgcagaagtctagggagagatttccatggcaacacaggcctcagcttcgaaatggcggaa 99214  
AL732594.5 >1081    ............................................................ 1140   

AL732548.9 >99215   ggcctcccgaaggataacagagaccctcgttttgttccagattatggttgcgatccgcaa 99274  
AL732594.5 >1141    ............................................................ 1200   

AL732548.9 >99275   acctacctcttttcaggcctctgcagttccccagaacctcaactcccaccatgactccat 99334  
AL732594.5 >1201    ............................................................ 1260   

AL732548.9 >99335   tgctgcgcagcccaaactacacctcccaggctgctctgcgcctctcttcccatgctcctc 99394  
AL732594.5 >1261    ............................................................ 1320   

AL732548.9 >99395   ttctcccgcgaggttgtgtagctctgtaaggccacgcccctcgactccagccgacctttg 99454  
AL732594.5 >1321    ............................................................ 1380   

AL732548.9 >99455   gcaactaccattcccaagatacttcgcacgtagtacgtttctgatacgtttccggccagt 99514  
AL732594.5 >1381    ............................................................ 1440   

AL732548.9 >99515   gacgcacttccactttgctaggcgcgcggttcccggtctgaaaagtagaacgcggatttg 99574  
AL732594.5 >1441    ............................................................ 1500   

AL732548.9 >99575   gctagggcctcgcgtctccgccgcccggcatggcctcctcacgagcctcctccacggtac 99634  
AL732594.5 >1501    ............................................................ 1560   

AL732548.9 >99635   ggagctctggatctaagctcaggcctgccctagagaggccgggggttcccgtgggaaagg 99694  
AL732594.5 >1561    ............................................................ 1620   

AL732548.9 >99695   gccgttaccttacgggtctgggccgaggaggaggaaagctgagggaccctagtgtggacc 99754  
AL732594.5 >1621    ............................................................ 1680   

AL732548.9 >99755   ttagtagccttttcctgatgtcttcgtgtgctgcagctctctttgcactgctcttactta 99814  
AL732594.5 >1681    ............................................................ 1740   

AL732548.9 >99815   agtcctgagcagagaccactctttctggctgctccaaaacacggtgctttggaatcgggt 99874  
AL732594.5 >1741    ............................................................ 1800   

AL732548.9 >99875   tgtgtcctgacttaagctgtccgactcgtacttactatgatgaggcttcccaacttgtaa 99934  
AL732594.5 >1801    ............................................................ 1860   

AL732548.9 >99935   tcggctctgaaagtatttgaaatgtgtattccagtcacatcgtgacttggtgcacctaga 99994  
AL732594.5 >1861    ............................................................ 1920   

AL732548.9 >99995   gccaccctgattgtttaggttgtttttagtgtctgcccagcagtgagaagttattttcgt 100054 
AL732594.5 >1921    ............................................................ 1980   

AL732548.9 >100055  aaaaccggagattgcttttc 100074 
AL732594.5 >1981    .................... 2000

Switch Points

Type	Point1	Point2	Orient1	Orient2	Curator	Comment	Time
A	100074	2001	+	+	chenhc	Taxid 10090 chrom 4 Reference assembly	2008-11-20 16:51:48.363

Events

Id	Type	Date	Whodid	Comment
170	ImportOldDb	09/02/2005 07:30:00	f_old_db
171	ReSetShortOvlp	09/04/2008 10:31:48	dbo
168229	CreateSwitchPt	11/20/2008 16:51:48	chenhc	tpf_builder 1.6 Toolkit wrapper version: built Nov 19 2008 using /netopt/ncbi_tools64/c++.by-date/20081119/GCC401-Release64/lib

BAC Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
C3H-112G18				AL732594.5	99.48%	pos 113587 (F+)
C3H-178O4	AL732594.5	99.56%	pos 97019 (R+)
C3H-178O4	AL732594.5	100%	pos 97212 (R+)
C3H-204M7				AL732594.5	99.01%	pos 133773 (F+)
C3H-224B18	AL732594.5	99.69%	pos 110581 (R-)	AL732594.5	99.83%	pos 46426 (F+)
C3H-224I17				AL732594.5	99.85%	pos 46422 (F+)
C3H-226J20	AL732594.5	99.34%	pos 131401 (R-)	AL732594.5	100%	pos 60447 (F+)
C3H-40I18	AL732548.9	99.59%	pos 8193 (R+)	AL732594.5	99.26%	pos 66488 (F-)
C3H-47D13				AL732594.5	99.36%	pos 90965 (F-)
C3H-55D2				AL732594.5	99.3%	pos 99425 (F-)
CH29-107O7	AL732548.9	99.34%	pos 88043 (R-)
CH29-114F20	AL732594.5	99.03%	pos 136724 (R-)	AL732548.9	100%	pos 49804 (F+)
CH29-174L2				AL732594.5	99.36%	pos 3095 (F+)
CH29-37M8				AL732548.9	100%	pos 33590 (F-)
CH29-485H12	AL732594.5	100%	pos 99921 (R-)
CH29-4G10				AL732594.5	99.2%	pos 3097 (F+)
CH29-525L11	AL732594.5	99.06%	pos 100019 (R-)
CH29-544P7				AL732594.5	99.86%	pos 27799 (F+)
CH29-558C7	AL732594.5	99.73%	pos 99954 (R-)	AL732548.9	99.87%	pos 34155 (F+)
CH29-561H10				AL732548.9	99.7%	pos 34065 (F-)
CH29-599P18	AL732548.9	99.54%	pos 91370 (R-)
CH29-602A22				AL732594.5	99.68%	pos 14271 (F+)
CH29-9C3	AL732594.5	99.29%	pos 29627 (R-)
RP23-77C20	AL732548.9	99.21%	pos 2346 (R+)
RP24-145C22	AL732594.5	99.6%	pos 69064 (R+)
RP24-147O13	AL732594.5	99.82%	pos 19602 (R-)
RP24-192F17				AL732548.9	99.31%	pos 78257 (F-)
RP24-230O21				AL732548.9	100%	pos 78720 (F-)
RP24-232P23				AL732594.5	100%	pos 62914 (F+)
RP24-235G6	AL732548.9	99%	pos 81069 (R-)
RP24-289G6	AL732594.5	99.85%	pos 17805 (R+)
RP24-304M8				AL732594.5	99.81%	pos 67428 (F+)
RP24-321P2	AL732548.9	99.05%	pos 16380 (R+)
RP24-373K4	AL732594.5	99.05%	pos 123185 (R-)
RP24-373L4	AL732594.5	99.09%	pos 123170 (R-)	AL732594.5	99.27%	pos 103370 (F+)

Fosmid Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
WI1-1093K12	AL732594.5	99.76%	pos 133252 (R-)	AL732594.5	100%	pos 92934 (F+)
WI1-121K15	AL732594.5	99.67%	pos 24939 (R-)
WI1-1247N22				AL732594.5	100%	pos 74551 (F+)
WI1-1260G13	AL732594.5	100%	pos 72539 (R-)	AL732594.5	99.84%	pos 29618 (F+)
WI1-1285C19	AL732594.5	100%	pos 78946 (R+)	AL732594.5	100%	pos 119426 (F-)
WI1-1285G21	AL732594.5	100%	pos 78946 (R+)	AL732594.5	99.84%	pos 119426 (F-)
WI1-1504I24				AL732594.5	99.81%	pos 140788 (F+)
WI1-1544O19	AL732594.5	100%	pos 94993 (R+)	AL732594.5	99.84%	pos 136784 (F-)
WI1-1563A1	AL732594.5	100%	pos 94888 (R-)
WI1-1709C10	AL732594.5	99.79%	pos 117692 (R-)
WI1-1735B20	AL732548.9	99.81%	pos 86552 (R-)	AL732548.9	100%	pos 40774 (F+)
WI1-1949P19	AL732594.5	99.34%	pos 118052 (R-)
WI1-195H24				AL732594.5	99.6%	pos 136069 (F+)
WI1-1996O22	AL732594.5	99.19%	pos 106885 (R-)
WI1-2021N13	AL732594.5	100%	pos 54711 (R+)	AL732594.5	99.68%	pos 92440 (F-)
WI1-2079E10	AL732548.9	100%	pos 41290 (R+)	AL732548.9	99.56%	pos 81066 (F-)
WI1-2100O5	AL732548.9	100%	pos 10322 (R+)	AL732548.9	99.65%	pos 51332 (F-)
WI1-210B8				AL732594.5	100%	pos 118257 (F+)
WI1-2122G19	AL732548.9	99.78%	pos 86363 (R+)	AL732594.5	100%	pos 32422 (F-)
WI1-2144K6	AL732594.5	99.77%	pos 27520 (R+)	AL732594.5	100%	pos 67971 (F-)
WI1-215N23	AL732548.9	100%	pos 11129 (R+)	AL732548.9	100%	pos 52148 (F-)
WI1-2200L18				AL732594.5	99.82%	pos 16048 (F+)
WI1-2222P6	AL732594.5	100%	pos 24386 (R+)	AL732594.5	99.29%	pos 63334 (F-)
WI1-2227M10	AL732548.9	99.04%	pos 91259 (R-)	AL732548.9	100%	pos 51387 (F+)
WI1-226L6	AL732594.5	99.02%	pos 11911 (R+)
WI1-2321G20	AL732594.5	100%	pos 15852 (R+)	AL732594.5	99.65%	pos 53508 (F-)
WI1-2348P15				AL732548.9	100%	pos 13352 (F-)
WI1-2473C10	AL732594.5	100%	pos 109388 (R-)	AL732594.5	100%	pos 72467 (F+)
WI1-2497K12	AL732548.9	100%	pos 71169 (R-)	AL732548.9	100%	pos 34826 (F+)
WI1-2518D12	AL732594.5	100%	pos 68830 (R+)	AL732594.5	100%	pos 109007 (F-)
WI1-2669K20	AL732548.9	100%	pos 88981 (R+)	AL732594.5	100%	pos 28215 (F-)
WI1-2729P20	AL732548.9	100%	pos 7420 (R+)	AL732548.9	99.85%	pos 45812 (F-)
WI1-27O23	AL732548.9	99.85%	pos 11129 (R+)	AL732548.9	99.85%	pos 52148 (F-)
WI1-343H24	AL732594.5	100%	pos 1378 (R-)	AL732548.9	99.85%	pos 55086 (F+)
WI1-343H24	AL732548.9	100%	pos 99452 (R-)
WI1-376N4	AL732548.9	100%	pos 38388 (R+)	AL732548.9	100%	pos 77906 (F-)
WI1-482I1	AL732594.5	99.74%	pos 113537 (R+)
WI1-487E16				AL732594.5	100%	pos 140452 (F-)
WI1-527O9	AL732594.5	100%	pos 139026 (R-)	AL732594.5	100%	pos 99612 (F+)
WI1-56K20	AL732548.9	99.21%	pos 15120 (R-)
WI1-622J11	AL732594.5	99.23%	pos 29933 (R+)	AL732594.5	99.15%	pos 72421 (F-)
WI1-822F10	AL732548.9	100%	pos 15943 (R-)
WI1-846H6	AL732548.9	100%	pos 83921 (R+)	AL732594.5	100%	pos 26189 (F-)
WI1-975N5	AL732594.5	99.76%	pos 115652 (R+)

NCBI

Join Evaluation Legend

Curator Links

Alignment for AL732548.9 and AL732594.5

Alignment Summary

Alignment 1 of 1