PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:233361 Links RH144115 Primer Information Forward primer: GACGGCAATCATAAGCCACT Reverse primer: CTCACGAACGTTTCTGTCCA PCR product size: 121 (bp), Rattus norvegicus    Homo sapiens Name: RH144115 Polymorphism info:      Rattus norvegicus Name: RH144115 Also known as: AW523593 Polymorphism info:   Cross References Gene GeneID: 84356   Symbol: Abcd2   Description: ATP-binding cassette, sub-family D (ALD), member 2   Position: 7q35 UniGene Rn.19678 ATP-binding cassette, sub-family D (ALD), member 2 RGD RGD:100062   Mapping Information RH144115 Sequence Map: Chr 7|Celera Map Viewer   Position: 118761506-118761626 (bp)   RH144115 Sequence Map: Chr 7 Map Viewer   Position: 129590697-129590817 (bp)   AW523593 MCW RH Map: Chr 7 Map Viewer   Position: 976.10 (cR)   Lod score: 15 Electronic PCR results RefSeq mRNA (1) NM_033352.1 547 .. 667 (121 bp)     mRNA (1) AF131294.1 547 .. 667 (121 bp)     Genomic (4) AC120768.5 92643 .. 92763 (121 bp)   CM000078.1 129590697 .. 129590817 (121 bp)   CH474027.1 4807189 .. 4807309 (121 bp)   CM000237.2 118761506 .. 118761626 (121 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC094073.6 100932 .. 101052 (121 bp)     ESTs (1) AW523593.1 86 .. 206 (121 bp)     Whole Genome Shotgun sequences (2) AABR03055360.1 91446 .. 91566 (121 bp)   AAHX01052254.1 63238 .. 63358 (121 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement