PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:42360 Links D3S1555 Homo sapiens chromosome 3, polymorphic Macaca mulatta chromosome 2 Pan troglodytes chromosome 3 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GAAGGTGATGAAGCCAAGAG Reverse primer: CGGGAGTGACATGACATGAT PCR product size: 221-237 (bp), Homo sapiens GenBank Accession: Z23315    Homo sapiens Name: D3S1555 Also known as: 056XF12 AFM056xf12 GDB:199255 HS056XF12 SHGC-69263 Polymorphism info: on genetic map Cross References Mapping Information D3S1555 Sequence Map: Chr 3|HuRef Map Viewer   Position: 146179114-146179348 (bp)   D3S1555 Sequence Map: Chr 3|Celera Map Viewer   Position: 147217467-147217695 (bp)   D3S1555 Sequence Map: Chr 3 Map Viewer   Position: 150289891-150290111 (bp)   D3S1555 deCODE Map: Chr 3 Map Viewer   Position: 156.59 (cM)   AFM056xf12 Genethon Map: Chr 3 Map Viewer   Position: 169.40 (cM)   AFM056xf12 Marshfield Map: Chr 3 Map Viewer   Position: 165.32 (cM)   SHGC-69263 TNG Map: Chr 3 Map Viewer   Position: 83924 (cR50000)   Lod score: 15.1   Reference Interval: 196   AFM056xf12 GeneMap99-GB4 Map: Chr 3 Map Viewer   Position: 543.71 (cR3000)   Lod score: F   Reference Interval: D3S1555-D3S1299   D3S1555 Whitehead-YAC Map: Chr 3 Map Viewer   Reference Interval: WC3.18 Electronic PCR results Genomic (7) Z23315.1 182 .. 404 (223 bp)   AC021059.25 120716 .. 120936 (221 bp)   CH003450.1 146573664 .. 146573898 (235 bp)   CH471052.2 55403137 .. 55403365 (229 bp)   CM000254.1 147217467 .. 147217695 (229 bp)   DS486015.1 45249683 .. 45249917 (235 bp)   CM000464.1 146179114 .. 146179348 (235 bp)     Whole Genome Shotgun sequences (3) AADD01038800.1 27489 .. 27723 (235 bp)   AADB02005077.1 495 .. 723 (229 bp)   ABBA01058948.1 8193 .. 8427 (235 bp)        Macaca mulatta Name: D3S1555 Polymorphism info:   Mapping Information D3S1555 Sequence Map: Chr 2 Map Viewer   Position: 138707386-138707609 (bp)    Pan troglodytes Name: D3S1555 Polymorphism info:   Mapping Information D3S1555 Sequence Map: Chr 3 Map Viewer   Position: 153947979-153948203 (bp)   D3S1555 Sequence Map: Chr 3 Map Viewer   Position: 153948713-153948941 (bp) Electronic PCR results Genomic (3) CM000317.1 153947979 .. 153948203 (225 bp)   CM000317.1 153947979 .. 153948941 (963 bp)   CM000317.1 153948713 .. 153948941 (229 bp)     Whole Genome Shotgun sequences (3) AADA01140073.1 441 .. 665 (225 bp)   AACZ02041315.1 63 .. 291 (229 bp)   AACZ02041314.1 2214 .. 2438 (225 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement