ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:277732 Links
SLC22A3_408
Homo sapiens chromosome 6, locus SLC22A3
Macaca mulatta chromosome 4, locus LOC709454
Pan troglodytes chromosome 6, locus SLC22A3

Found by e-PCR in sequences from Homo sapiens and Pan troglodytes.

Primer InformationHelp

Forward primer:TAAAAGTGAAGGGATATTTTT
Reverse primer:AGAGTCTGAATGTTATTCTGG
PCR product size:853 (bp), Macaca mulatta
GenBank Accession:BV166738

   Homo sapiens
Name: SLC22A3_408
Polymorphism info:  

Cross References Help
Gene GeneID:6581
 Symbol:SLC22A3
 Description:solute carrier family 22 (extraneuronal monoamine transporter), member 3
 Position:6q26-q27
UniGeneHs.567337 Solute carrier family 22 (extraneuronal monoamine transporter), member 3

Mapping InformationHelp
SLC22A3_408 Sequence Map: Chr 6|HuRef Map Viewer
  Position: 158347528-158348423 (bp)
 
SLC22A3_408 Sequence Map: Chr 6 Map Viewer
  Position: 160792915-160793810 (bp)
 
SLC22A3_408 Sequence Map: Chr 6|Celera Map Viewer
  Position: 161524397-161525292 (bp)

Electronic PCR results Help
RefSeq mRNA (1)
NM_021977.2 2535 .. 3430 (896 bp)  
 
Genomic (5 of 8)[Show All Hits]
AL591069.5 100028 .. 100923 (896 bp)  
G73331.1 471 .. 1366 (896 bp)  
CH003453.1 157881715 .. 157882610 (896 bp)  
CH003501.1 164665905 .. 164666800 (896 bp)  
CH471051.2 93593001 .. 93593896 (896 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (2)
AC040893.1 33804 .. 34699 (896 bp)  
AL645523.3 215720 .. 216615 (896 bp)  
 
Whole Genome Shotgun sequences (4)
AADD01076912.1 44042 .. 44937 (896 bp)  
AADC01065482.1 155913 .. 156808 (896 bp)  
AADB02010239.1 152753 .. 153648 (896 bp)  
ABBA01021054.1 82976 .. 83871 (896 bp)  
 

   Macaca mulatta
Name: SLC22A3_408
Polymorphism info:  

Cross References Help
Gene GeneID:709454
 Symbol:LOC709454
 Description:similar to solute carrier family 22 member 3
 Position: 
UniGeneMmu.16686 Similar to solute carrier family 22 member 3

Mapping InformationHelp
SLC22A3_408 Sequence Map: Chr 4 Map Viewer
  Position: 157432812-157433706 (bp)
 
SLC22A3_408 Sequence Map: Chr 4 Map Viewer
  Position: 157641605-157642497 (bp)

   Pan troglodytes
Name: SLC22A3_408
Polymorphism info:  

Cross References Help
Gene GeneID:463114
 Symbol:SLC22A3
 Description:solute carrier family 22 (extraneuronal monoamine transporter), member 3
 Position: 

Mapping InformationHelp
SLC22A3_408 Sequence Map: Chr 6 Map Viewer
  Position: 163402469-163403364 (bp)

Electronic PCR results Help
RefSeq mRNA (2)
XM_001152133.1 2551 .. 3446 (896 bp)  
XM_001152073.1 2557 .. 3452 (896 bp)  
 
Genomic (1)
CM000320.1 163402469 .. 163403364 (896 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (1)
AC132187.1 43553 .. 44448 (896 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01187274.1 3645 .. 4540 (896 bp)  
AACZ02077282.1 16015 .. 16910 (896 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement