Join Evaluation Legend

Serious alignment problem, requires review. (details...)
- Zero, or more than one, overlaps
- Half dove-tail >50 bp
- Alignment identity <98%
- Alignment length <100 bp
- >2 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Minor alignment problem. (details...)
- Exactly one overlap
- Half dove-tail >0 bp and <=50bp
- Alignment identity <99.1%
- Alignment length <2000 bp
- >0 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Excellent alignment, meets all defined criteria. (details...)
- Exactly one RuleInfo
- Half dove-tail <=0 bp
- Alignment identity >=99.1%
- Alignment length >=2000 bp
- <=0 gaps, each gap >25 bp, not marked as an SSR
- <=0 gaps, each gap >50 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, marked as an SSR
Certificate submitted, not yet approved.
Certificate submitted and approved.
Valid, contained clone
Join not evaluated due to one accession not being finished.

Curator Links

Add/Update certificate

Alignment for AL591065.17 and AL845484.9

AL591065.17 Mouse DNA sequence from clone RP23-199H17 on chromosome 11 Contains the Myo18a gene for myosin XVIIIa, the Pipox gene for pipecolic acid oxidase, a novel gene (LOC327969), the 5' end of the Sez6 gene for seizure related gene 6 and two CpG islands, complete sequence [htgs_phase3]

Length: 220,176 bp

AL845484.9 Mouse DNA sequence from clone RP23-336L14 on chromosome 11 Contains the 3' end of the Sez6 gene for seizure related gene 6, complete sequence [htgs_phase3]

Length: 47,702 bp

Alignment Summary

Join evaluation: green

Alignment count: 1

Go to Endhit Table

Alignment 1
Align ID: 791
Total Length: 2000
Aligned Length: 2000
Percent Identity: 100
Number of Gaps: 0
Number of Mismatches: 0
Source: CtgOverlap Seq-Align
Valid Switchpoint: true (A)

Alignment 1 of 1

 Mismatches = 0, Gaps = 0, Length = 2000
 Percent identity = 100%
 Score = 3965 bits (2000), Expect = 0
  5 BAC and 11 Fosmid bridging clones.
  5 BAC and 11 Fosmid concordant clones.
  0 BAC and 0 Fosmid discordant clones.

AL591065.17 >218177  tggcctggtcccaccttttcttccccgagaaaggctgagctgcttgtctgggcccagcag 218236 
AL845484.9  >1       ............................................................ 60     

AL591065.17 >218237  tgagggtttctgggccacgtgaccacagagttcatagaaggtaagagaaggtaagaagag 218296 
AL845484.9  >61      ............................................................ 120    

AL591065.17 >218297  gcaggagtcacacttggcttatgccctgagaaccccacagtttcaggaaaggggggaaga 218356 
AL845484.9  >121     ............................................................ 180    

AL591065.17 >218357  agaagcgtagagatgctggagagatggttccgtggctaagagtacatgctgttcttgaag 218416 
AL845484.9  >181     ............................................................ 240    

AL591065.17 >218417  aggacctgaaatctattcccaacacacactccagcagcgctcaattgctgaactccagtt 218476 
AL845484.9  >241     ............................................................ 300    

AL591065.17 >218477  cgagggtccaatgcccccttctggcctccttgggggagccagcagtggttgtctgaaggc 218536 
AL845484.9  >301     ............................................................ 360    

AL591065.17 >218537  tgagaggccattgcactgacatgtaaaagtacacattcatatacatgtaactttaaaaaa 218596 
AL845484.9  >361     ............................................................ 420    

AL591065.17 >218597  aaaagaattatttattgtatgcatatgagtatactgctgctgcttttagatacaccagaa 218656 
AL845484.9  >421     ............................................................ 480    

AL591065.17 >218657  gagggcaccagatcccattacagatggctgtgagtcaccatgtggttgctgggaattgaa 218716 
AL845484.9  >481     ............................................................ 540    

AL591065.17 >218717  ctcaggtcctctggaagagcagtcagtgctcttaaccactgggtgatctccccagcccta 218776 
AL845484.9  >541     ............................................................ 600    

AL591065.17 >218777  catgtaacttttaaaagaataaactagagcataggttactaattctgaaacagggggtaa 218836 
AL845484.9  >601     ............................................................ 660    

AL591065.17 >218837  aaggtaccaaggaacagtcataaagtggctggtgtgatggtcacaacgcaatcccagccc 218896 
AL845484.9  >661     ............................................................ 720    

AL591065.17 >218897  ctgagagactgaggcacgaaggtctgagttctaggccagcatgagctccatagccggacc 218956 
AL845484.9  >721     ............................................................ 780    

AL591065.17 >218957  ttgccaaagggtgaaggttgaagtgacctggggaaaaagcagccatcccttcccagttgg 219016 
AL845484.9  >781     ............................................................ 840    

AL591065.17 >219017  taaggaggtagcactgaaggttcgatctttccatgcaaggaacaagctaagcaacgatag 219076 
AL845484.9  >841     ............................................................ 900    

AL591065.17 >219077  agggacaagaaggggagggtgttggaggcatcggggacagccaggtgagcaaacagtggg 219136 
AL845484.9  >901     ............................................................ 960    

AL591065.17 >219137  aaggacctgcagtgtcaggtcaagacacgaggtacacaatgttgaggcttttgaggagaa 219196 
AL845484.9  >961     ............................................................ 1020   

AL591065.17 >219197  agggcaagaggtcagaactgctccttggggggagccagcagtggttgtctgaaggctgag 219256 
AL845484.9  >1021    ............................................................ 1080   

AL591065.17 >219257  aggccatcctggatagaggatttgatctggggcagtgactttgggaatggagaggaggga 219316 
AL845484.9  >1081    ............................................................ 1140   

AL591065.17 >219317  acggatgagagaacaggaacctgagttctggtccctggagatgaaaagatccaagatggc 219376 
AL845484.9  >1141    ............................................................ 1200   

AL591065.17 >219377  tacaaacccagaggcttgtggaggaagtgttgggtttgccgcatgacagacagctttggc 219436 
AL845484.9  >1201    ............................................................ 1260   

AL591065.17 >219437  ttctcgtcctcttggaatagaagagactttggcttttgagccttatttccttttatattt 219496 
AL845484.9  >1261    ............................................................ 1320   

AL591065.17 >219497  ttcctagtgctggtcagagaccttagatagacatgccctcttgcctcaaaggagcaccat 219556 
AL845484.9  >1321    ............................................................ 1380   

AL591065.17 >219557  ctagcggggaggctggaaagtggcttagtgtagccaacactggcgtggggtggcctcagt 219616 
AL845484.9  >1381    ............................................................ 1440   

AL591065.17 >219617  gtggcaggcatatgggccagccagagagctcagttccacactgaggagacctgggtggct 219676 
AL845484.9  >1441    ............................................................ 1500   

AL591065.17 >219677  tcccacagacatgaccgggagcaagtccagaaacgttagctcagggcagtttggtggagt 219736 
AL845484.9  >1501    ............................................................ 1560   

AL591065.17 >219737  ctgtgtgggagcatgcagaaacagcatgatacacagtgagtatgcctgaaggcttcagga 219796 
AL845484.9  >1561    ............................................................ 1620   

AL591065.17 >219797  agggaagatggaaaatcaatagagagaactcaggtcgtaatgggcttgagcttcatctca 219856 
AL845484.9  >1621    ............................................................ 1680   

AL591065.17 >219857  agagcaatagagaaccactgggtgattccaagtcaaagatggcatggggttctgtttgga 219916 
AL845484.9  >1681    ............................................................ 1740   

AL591065.17 >219917  ggccagctctatgctgagatcaagtagaaagttagcttgctcttccatagcgagtgagag 219976 
AL845484.9  >1741    ............................................................ 1800   

AL591065.17 >219977  acaaagcttatcctagaccctgagatccagattctactctgttgtcatctggagcctttg 220036 
AL845484.9  >1801    ............................................................ 1860   

AL591065.17 >220037  gggcaacggtgttctgtgtgggccatggtagtctggcctctgagagaagaactgtgtgca 220096 
AL845484.9  >1861    ............................................................ 1920   

AL591065.17 >220097  tctgagaataacaagagctgcctggaacccagcttcctgcttcaggtcctttcccggccc 220156 
AL845484.9  >1921    ............................................................ 1980   

AL591065.17 >220157  cattcaccttctatgaattc 220176 
AL845484.9  >1981    .................... 2000

Switch Points

Type	Point1	Point2	Orient1	Orient2	Curator	Comment	Time
A	220176	2001	+	+	chenhc	Taxid 10090 chrom 11 Reference assembly	2008-11-20 16:56:51.050

Events

Id	Type	Date	Whodid	Comment
1523	ImportOldDb	09/02/2005 09:06:00	f_old_db
1524	ReSetShortOvlp	09/04/2008 10:31:48	dbo
174367	CreateSwitchPt	11/20/2008 16:56:51	chenhc	tpf_builder 1.6 Toolkit wrapper version: built Nov 19 2008 using /netopt/ncbi_tools64/c++.by-date/20081119/GCC401-Release64/lib

BAC Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
C3H-157C17				AL591065.17	99.48%	pos 180004 (F-)
C3H-160M19				AL591065.17	100%	pos 128430 (F-)
C3H-160M20				AL591065.17	100%	pos 128429 (F-)
C3H-226M17	AL591065.17	99.18%	pos 6326 (R+)	AL591065.17	100%	pos 166176 (F-)
C3H-229K24				AL591065.17	100%	pos 19334 (F-)
C3H-243K10	AL591065.17	99.05%	pos 53233 (R+)	AL591065.17	100%	pos 178103 (F-)
C3H-243M6				AL591065.17	99.47%	pos 21454 (F+)
C3H-2F1				AL845484.9	99.29%	pos 34929 (F+)
C3H-92D15				AL591065.17	99.1%	pos 175966 (F-)
CH29-17P4				AL591065.17	99.19%	pos 142593 (F+)
CH29-31E11	AL591065.17	99.27%	pos 38807 (R-)
CH29-497I13	AL591065.17	99.11%	pos 8436 (R+)	AL591065.17	99.12%	pos 219925 (F-)
CH29-497I13				AL845484.9	99.12%	pos 1749 (F-)
CH29-497J13	AL591065.17	99.85%	pos 8531 (R+)	AL591065.17	100%	pos 220057 (F-)
CH29-497J13				AL845484.9	100%	pos 1881 (F-)
CH29-548K6	AL591065.17	99.6%	pos 67069 (R+)	AL845484.9	99.63%	pos 26555 (F-)
CH29-579C23	AL591065.17	99.74%	pos 75138 (R-)
CH29-63M22				AL845484.9	99.59%	pos 36948 (F+)
CH29-92E6	AL591065.17	100%	pos 4321 (R+)	AL845484.9	99.62%	pos 26511 (F-)
RP24-117P10	AL591065.17	99.29%	pos 104115 (R+)
RP24-178E11				AL591065.17	100%	pos 197009 (F-)
RP24-212J22	AL591065.17	99.37%	pos 53219 (R+)	AL591065.17	99.29%	pos 194247 (F-)
RP24-305P21				AL591065.17	99.8%	pos 216343 (F+)
RP24-357N12	AL591065.17	99.55%	pos 71772 (R+)
RP24-368C4	AL845484.9	99.17%	pos 20735 (R-)	AL591065.17	99.18%	pos 27160 (F+)
RP24-395H23				AL591065.17	100%	pos 201761 (F+)

Fosmid Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
WI1-103P5	AL845484.9	100%	pos 27859 (R+)
WI1-1069G17	AL591065.17	100%	pos 33310 (R-)
WI1-1108F20	AL591065.17	99.39%	pos 75522 (R+)	AL591065.17	100%	pos 118079 (F-)
WI1-1185C5	AL845484.9	100%	pos 27860 (R+)
WI1-1234A12	AL591065.17	99.8%	pos 80604 (R-)	AL591065.17	100%	pos 41981 (F+)
WI1-1251B15	AL591065.17	99.84%	pos 168882 (R-)	AL591065.17	99.85%	pos 129437 (F+)
WI1-1278D24				AL845484.9	99.78%	pos 20373 (F+)
WI1-1298G7	AL591065.17	100%	pos 25780 (R+)	AL591065.17	99.77%	pos 68655 (F-)
WI1-1342J9				AL845484.9	100%	pos 13130 (F+)
WI1-1444K1	AL845484.9	99.64%	pos 47143 (R-)	AL845484.9	99.71%	pos 10951 (F+)
WI1-1669I14				AL845484.9	99.61%	pos 13158 (F+)
WI1-1740A20				AL591065.17	100%	pos 3393 (F-)
WI1-178D23	AL845484.9	100%	pos 39586 (R-)	AL591065.17	100%	pos 219022 (F+)
WI1-178D23				AL845484.9	100%	pos 846 (F+)
WI1-1828M9	AL591065.17	99.47%	pos 187680 (R-)
WI1-1902B20	AL591065.17	99.57%	pos 2288 (R+)	AL591065.17	99.81%	pos 44515 (F-)
WI1-1918K9	AL845484.9	100%	pos 25459 (R-)	AL591065.17	100%	pos 203748 (F+)
WI1-1955E12				AL845484.9	100%	pos 35129 (F-)
WI1-1956A5	AL591065.17	100%	pos 3074 (R+)	AL591065.17	100%	pos 48195 (F-)
WI1-1956E5	AL591065.17	99.34%	pos 3083 (R+)	AL591065.17	99.73%	pos 48193 (F-)
WI1-1981A15				AL591065.17	100%	pos 25752 (F-)
WI1-2034B7	AL591065.17	99.81%	pos 189130 (R+)	AL845484.9	100%	pos 12861 (F-)
WI1-2138D3	AL591065.17	100%	pos 149110 (R+)	AL591065.17	99.63%	pos 189692 (F-)
WI1-2165C2	AL591065.17	100%	pos 150111 (R+)	AL591065.17	100%	pos 188733 (F-)
WI1-2165P14				AL591065.17	99.79%	pos 51628 (F-)
WI1-2228G21				AL591065.17	99.65%	pos 32607 (F-)
WI1-228N17	AL591065.17	100%	pos 80475 (R-)	AL591065.17	100%	pos 40140 (F+)
WI1-2303L13	AL591065.17	99.24%	pos 25776 (R+)
WI1-2307G22				AL845484.9	100%	pos 13155 (F+)
WI1-2355B16	AL591065.17	100%	pos 20872 (R+)	AL591065.17	100%	pos 64459 (F-)
WI1-2363O17	AL845484.9	100%	pos 7428 (R-)	AL591065.17	100%	pos 183044 (F+)
WI1-2367D1	AL591065.17	100%	pos 70299 (R-)	AL591065.17	100%	pos 29688 (F+)
WI1-2372K8	AL591065.17	99.81%	pos 91642 (R+)	AL591065.17	100%	pos 136629 (F-)
WI1-2381J16	AL591065.17	100%	pos 85842 (R+)	AL591065.17	100%	pos 125783 (F-)
WI1-2406L11	AL591065.17	99.53%	pos 129050 (R-)	AL591065.17	100%	pos 94096 (F+)
WI1-2411C20	AL591065.17	99.86%	pos 138551 (R-)	AL591065.17	100%	pos 95733 (F+)
WI1-2412F21				AL591065.17	100%	pos 35261 (F-)
WI1-2427O8	AL591065.17	99.74%	pos 104340 (R+)	AL591065.17	100%	pos 142837 (F-)
WI1-2500H9	AL591065.17	99.03%	pos 11817 (R+)	AL591065.17	100%	pos 51489 (F-)
WI1-2561D12	AL591065.17	100%	pos 18720 (R+)	AL591065.17	99.74%	pos 55347 (F-)
WI1-258L11	AL591065.17	100%	pos 22776 (R-)
WI1-2592O20	AL591065.17	100%	pos 136209 (R-)
WI1-261A16	AL845484.9	99.78%	pos 12443 (R+)
WI1-2635L24				AL591065.17	99.65%	pos 90198 (F-)
WI1-2645I12	AL591065.17	99.84%	pos 76063 (R+)	AL591065.17	99.82%	pos 117304 (F-)
WI1-2646B4	AL845484.9	100%	pos 41748 (R+)
WI1-2811E1				AL591065.17	100%	pos 90468 (F-)
WI1-2839F2	AL591065.17	100%	pos 195638 (R+)	AL845484.9	99.77%	pos 15025 (F-)
WI1-2862E6	AL591065.17	99.67%	pos 166192 (R+)	AL591065.17	99.37%	pos 204896 (F-)
WI1-2864L7	AL591065.17	100%	pos 67050 (R-)	AL591065.17	100%	pos 25790 (F+)
WI1-2864P6	AL591065.17	100%	pos 95280 (R-)	AL591065.17	100%	pos 56213 (F+)
WI1-2890L8	AL591065.17	99.81%	pos 215860 (R-)	AL591065.17	100%	pos 175072 (F+)
WI1-298J22	AL591065.17	100%	pos 183791 (R+)	AL845484.9	99.27%	pos 2767 (F-)
WI1-328F22	AL845484.9	100%	pos 12113 (R-)	AL591065.17	100%	pos 188289 (F+)
WI1-345P11	AL591065.17	99.77%	pos 24336 (R-)
WI1-358I15	AL591065.17	100%	pos 91230 (R+)	AL591065.17	99.69%	pos 127965 (F-)
WI1-383K9	AL845484.9	99.7%	pos 12952 (R-)	AL591065.17	99.3%	pos 190632 (F+)
WI1-424D22	AL845484.9	99.71%	pos 12510 (R-)	AL591065.17	99.69%	pos 190189 (F+)
WI1-497D3				AL845484.9	100%	pos 22801 (F+)
WI1-513B9	AL591065.17	99.09%	pos 159336 (R-)	AL591065.17	99.83%	pos 118946 (F+)
WI1-521C7	AL845484.9	99.79%	pos 25944 (R-)	AL591065.17	100%	pos 204699 (F+)
WI1-538G21				AL845484.9	100%	pos 35129 (F-)
WI1-673B18	AL591065.17	99.18%	pos 11924 (R-)
WI1-681K20				AL845484.9	100%	pos 12253 (F+)
WI1-747A3	AL591065.17	100%	pos 163886 (R+)	AL591065.17	100%	pos 200416 (F-)
WI1-810E14	AL591065.17	100%	pos 66543 (R-)	AL591065.17	99.6%	pos 24852 (F+)
WI1-82O2	AL591065.17	99.83%	pos 48536 (R+)
WI1-871H7	AL591065.17	99.85%	pos 136377 (R-)	AL591065.17	99.82%	pos 102305 (F+)
WI1-890N5	AL591065.17	99.27%	pos 92185 (R+)	AL591065.17	99.18%	pos 135666 (F-)
WI1-900A7	AL591065.17	100%	pos 201791 (R+)	AL845484.9	100%	pos 20488 (F-)
WI1-909L13				AL845484.9	100%	pos 13142 (F+)

NCBI

Join Evaluation Legend

Curator Links

Alignment for AL591065.17 and AL845484.9

Alignment Summary

Alignment 1 of 1