ncbi logo
UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:10840 Links
WIAF-1688
Homo sapiens chromosome 11, locus ARHGAP20
Pan troglodytes chromosome 11, locus ARHGAP20

Found by e-PCR in sequences from Homo sapiens and Pan troglodytes.

Primer InformationHelp

Forward primer:ACTTCTTCTATTTAGAAGGTGAC
Reverse primer:AGAAACATTTCAGCAAAG
PCR product size:142 (bp), Homo sapiens
GenBank Accession:G43189

   Homo sapiens
Name: WIAF-1688
Also known as: A006Q33 WIAF-1688-STS
Polymorphism info:  

Cross References Help
Gene GeneID:57569
 Symbol:ARHGAP20
 Description:Rho GTPase activating protein 20
 Position:11q22.3-q23.1
UniGeneHs.6136 Rho GTPase activating protein 20

Mapping InformationHelp
WIAF-1688 Sequence Map: Chr 11|HuRef Map Viewer
  Position: 106373794-106373935 (bp)
 
WIAF-1688 Sequence Map: Chr 11|Celera Map Viewer
  Position: 107602633-107602774 (bp)
 
WIAF-1688 Sequence Map: Chr 11 Map Viewer
  Position: 109954360-109954501 (bp)
 
A006Q33 NCBI RH Map: Chr 11 Map Viewer
  Position: 1004 (cR)
  Lod score: 1.13
 
A006Q33 GeneMap99-GB4 Map: Chr 11 Map Viewer
  Position: 369.14 (cR3000)
  Lod score: 0.01
  Reference Interval: D11S1343-D11S1347

Electronic PCR results Help
RefSeq mRNA (1)
NM_020809.2 4664 .. 4805 (142 bp)  
 
mRNA (5 of 6)[Show All Hits]
AB037812.1 4389 .. 4530 (142 bp)  
AY496263.1 4664 .. 4805 (142 bp)  
AY496264.1 4367 .. 4508 (142 bp)  
AY496265.1 4485 .. 4626 (142 bp)  
AY496266.1 4667 .. 4808 (142 bp)  
 
Genomic (5 of 10)[Show All Hits]
G43189.1 1 .. 142 (142 bp)  
AP001883.6 99950 .. 100091 (142 bp)  
CH003458.1 107107254 .. 107107395 (142 bp)  
CH003506.1 111796035 .. 111796176 (142 bp)  
BV197133.1 1 .. 142 (142 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (1)
AC036150.2 148673 .. 148814 (142 bp)  
 
Low-pass Sequence Sampling (from GenBank HTGS division) (1)
AC015690.3 5419 .. 5560 (142 bp)  
 
ESTs (3)
Z43854.1 142 .. 283 (142 bp)  
DA182369.1 293 .. 434 (142 bp)  
DB487863.1 167 .. 308 (142 bp)  
 
Whole Genome Shotgun sequences (4)
AADD01119364.1 25050 .. 25191 (142 bp)  
AADC01101882.1 21098 .. 21239 (142 bp)  
AADB02014349.1 1425596 .. 1425737 (142 bp)  
ABBA01039831.1 80453 .. 80594 (142 bp)  
 

   Pan troglodytes
Name: WIAF-1688
Polymorphism info:  

Cross References Help
Gene GeneID:466777
 Symbol:ARHGAP20
 Description:Rho GTPase activating protein 20
 Position: 

Mapping InformationHelp
WIAF-1688 Sequence Map: Chr 11 Map Viewer
  Position: 109333943-109334084 (bp)

Electronic PCR results Help
RefSeq mRNA (1)
XM_522177.2 4475 .. 4616 (142 bp)  
 
Genomic (1)
CM000325.1 109333943 .. 109334084 (142 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01245046.1 7185 .. 7326 (142 bp)  
AACZ02128147.1 4047 .. 4188 (142 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement