refSNP ID: rs3820447 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 107/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/G Ancestral Allele: G Clinical Association: unknown HGVS Names NT_004487.18:g.365356C>T Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss5006866 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs3820447 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss5006866 YUSUKE|IMS-JST181118 fwd/T A/G ccccacatgctggacgtagccctcttcctc cacccctgggagggacccatccatctccct 08/12/02 10/25/06 107 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs3820447|allelePos=61|totalLen=102|taxid=9606|snpclass=1|alleles='A/G'|mol=Genomic|build=107 AGTGTGTGCC CTGTGCCCTT GTCCCTCACT CCCCACATGC TGGACGTAGC CCTCTTCCTC R CACCCCTGGG AGGGACCCAT CCATCTCCCT TGCTCTCCTG G   GeneView GeneView via analysis of contig annotation: SV2A synaptic vesicle glycoprotein 2A View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_004487->NM_014849 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_004487->NM_014849->NP_055664 365356 reverse 3' near gene GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs3820447 maps exactly once on NCBI human chromosome 1 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 1 NW_001838529.1 73316 121255485 minus C alt_assembly_8 HuRef HuRef view 60 1 NW_925683.1 27797 122990971 minus C alt_assembly_1 Celera Celera view 60 1 NT_004487.18 365356 148141625 minus C ref_assembly reference reference view 60   NCBI Resource Links Submitter-Referenced GenBank NT_004705.1 dbSNP Blast Analysis GenBank HTGS Finished: GenBank mRNA: AL591493.14 AB018279.1 UniGene Cluster ID 516153   Population Diversity Sample Ascertainment Genotype Detail Alleles ss# Population Individual Group Chrom. Sample Cnt. Source A/G G/G HWP A G ss5006866 HapMap-CEU European 120 IG 1.000 1.000 HapMap-HCB Asian 90 IG 1.000 1.000 HapMap-JPT Asian 88 IG 0.045 0.955 1.000 0.023 0.977 HapMap-YRI Sub-Saharan African 114 IG 1.000 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0.010+/-0.069 270 210 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .