PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:69623 Links A008B39 Homo sapiens chromosome 11, locus NAP1L4 Pan troglodytes locus NAP1L4 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TGAAGATTCTGAATTCACATTAG Reverse primer: CTTCAAAATTGTCATCATCTTCT PCR product size: 125 (bp), Homo sapiens    Homo sapiens Name: A008B39 Also known as: Polymorphism info:   Cross References Gene GeneID: 4676   Symbol: NAP1L4   Description: nucleosome assembly protein 1-like 4   Position: 11p15.5 UniGene Hs.501684 Nucleosome assembly protein 1-like 4 Mapping Information View all results using the Map Viewer   A008B39 NCBI RH Map: Chr 11 Map Viewer   Position: 10 (cR)   Lod score: 1.42   A008B39 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 26.57 (cR3000)   Lod score: 2.12   Reference Interval: D11S1318-D11S909 Electronic PCR results RefSeq mRNA (1) NM_005969.3 1059 .. 1183 (125 bp)     mRNA (2) U77456.1 1067 .. 1191 (125 bp)   BC022090.2 969 .. 1093 (125 bp)     Genomic (1) AY401043.1 904 .. 1028 (125 bp)     ESTs (5 of 77)[Show All Hits] F06995.1 122 .. 244 (123 bp)   R11795.1 130 .. 254 (125 bp)   H07028.1 121 .. 243 (123 bp)   AW246975.1 46 .. 170 (125 bp)   AW387529.1 65 .. 189 (125 bp)        Macaca mulatta   Polymorphism info:   Cross References UniGene Mmu.1442 Nucleosome assembly protein 1-like 4    Pan troglodytes   Polymorphism info:   Cross References Gene GeneID: 450961   Symbol: NAP1L4   Description: nucleosome assembly protein 1-like 4   Position:   Electronic PCR results RefSeq mRNA (1) XM_508227.2 989 .. 1113 (125 bp)     Genomic (1) AY401044.1 904 .. 1028 (125 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement