PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:59920 Links WI-12365 Homo sapiens chromosome X, locus HUWE1 Pan troglodytes chromosome X, locus HUWE1 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: GTTTTGGCTAATTTCTGGCA Reverse primer: AGATGTATATGTGCTTTTCTGGAA PCR product size: 150 (bp), Homo sapiens GenBank Accession: G13422 T81421    Homo sapiens Name: WI-12365 Also known as: EST143806 stWI-12365 Polymorphism info:   Cross References Gene GeneID: 10075   Symbol: HUWE1   Description: HECT, UBA and WWE domain containing 1   Position: Xp11.22 UniGene Hs.136905 HECT, UBA and WWE domain containing 1 Mapping Information WI-12365 Sequence Map: Chr X|HuRef Map Viewer   Position: 50691522-50691671 (bp)   WI-12365 Sequence Map: Chr X Map Viewer   Position: 53652358-53652507 (bp)   WI-12365 Sequence Map: Chr X|Celera Map Viewer   Position: 57467196-57467345 (bp)   WI-12365 NCBI RH Map: Chr X Map Viewer   Position: 290.3 (cR)   Lod score: 1.46   WI-12365 Whitehead-RH Map: Chr X Map Viewer   Position: 95.2 (cR3000)   Lod score: P>3.00   WI-12365 GeneMap99-GB4 Map: Chr X Map Viewer   Position: 166.50 (cR3000)   Lod score: 3.00   Reference Interval: DXS1039-DXS991 Electronic PCR results Genomic (5 of 8)[Show All Hits] G13422.1 1 .. 150 (150 bp)   AL592046.7 74068 .. 74217 (150 bp)   AL832105.1 1249 .. 1398 (150 bp)   CH471154.1 628434 .. 628583 (150 bp)   CM000274.1 57467196 .. 57467345 (150 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC031980.1 29083 .. 29232 (150 bp)     ESTs (2) T81421.1 1 .. 150 (150 bp)   R16079.1 1 .. 150 (150 bp)     Whole Genome Shotgun sequences (2) AADB02036352.1 518626 .. 518775 (150 bp)   ABBA01056441.1 1790 .. 1939 (150 bp)        Pan troglodytes Name: WI-12365 Polymorphism info:   Cross References Gene GeneID: 465650   Symbol: HUWE1   Description: HECT, UBA and WWE domain containing 1   Position:   Mapping Information WI-12365 Sequence Map: Chr X Map Viewer   Position: 54034521-54034670 (bp) Electronic PCR results Genomic (1) CM000336.1 54034521 .. 54034670 (150 bp)     Whole Genome Shotgun sequences (2) AADA01073811.1 981 .. 1130 (150 bp)   AACZ02207276.1 3330 .. 3479 (150 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement