refSNP ID: rs4147979 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 110/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/G Ancestral Allele: G Clinical Association: unknown HGVS Names NM_007168.2:c.991G>A NP_009099.1:p.G331S NT_010641.15:g.851595C>T Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss5601607 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs4147979 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss5601607 RIKENSNPRC|ssj0001661 fwd/T A/G agcatcttggtaaagaaatctttcctcacc gcctggtcgtgttcctcctcactgtctttt 10/18/02 10/10/03 110 Genomic unknown ss74895575 ILLUMINA|ILMN_Human_1M_rs4147979 fwd/T A/G agcatcttggtaaagaaatctttcctcacc gcctggtcgtgttcctcctcactgtctttt 08/28/07 08/29/07 129 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs4147979|allelePos=61|totalLen=121|taxid=9606|snpclass=1|alleles='A/G'|mol=Genomic|build=129 TCATTTTAGG TAGCTTTGGC TTTCTTAATG AGCATCTTGG TAAAGAAATC TTTCCTCACC R GCCTGGTCGT GTTCCTCCTC ACTGTCTTTT GGGGGTGTCT GGGGTTCACA TCACTGTACA   GeneView GeneView via analysis of contig annotation: ABCA8 ATP-binding cassette, sub-family A (ABC1), member 8 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_010641->NM_007168 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_010641->NM_007168->NP_009099 851596 reverse 1170 missense A Ser [S] 1 331 contig reference G Gly [G] 1 331 GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs4147979 maps exactly once on NCBI human chromosome 17 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 17 NW_001838454.2 8595953 62311269 plus G alt_assembly_8 HuRef HuRef view 60 17 NW_926918.1 4002558 63497157 minus C alt_assembly_1 Celera Celera view 60 17 NT_010641.15 851596 64436919 minus C ref_assembly reference reference view 60   NCBI Resource Links Submitter-Referenced GenBank AC015844.5 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): NM_007168.2 UniGene Cluster ID 58351   Population Diversity Sample Ascertainment Genotype Detail Alleles ss# Population Individual Group Chrom. Sample Cnt. Source G/G HWP G ss5601607 HapMap-CEU European 120 IG 1.000 1.000 HapMap-HCB Asian 90 IG 1.000 1.000 HapMap-JPT Asian 90 IG 1.000 1.000 HapMap-YRI Sub-Saharan African 120 IG 1.000 1.000 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 270 210 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .