PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:13103 Links D20S558E Homo sapiens chromosome 20, locus C20orf39 Macaca mulatta chromosome 10, locus LOC704737 Pan troglodytes chromosome 20, locus LOC740833 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: AGCATGAAGCAAGAGTTGCAC Reverse primer: CTCACCCCGTCATAAGCAG PCR product size: 117 (bp), Homo sapiens    Homo sapiens Name: D20S558E Also known as: GDB:441198 stSG3002 Polymorphism info:   Cross References Gene GeneID: 79953   Symbol: C20orf39   Description: chromosome 20 open reading frame 39   Position: 20p11.21 UniGene Hs.124638 Chromosome 20 open reading frame 39 Mapping Information D20S558E Sequence Map: Chr 20 Map Viewer   Position: 24594996-24595112 (bp)   D20S558E Sequence Map: Chr 20|HuRef Map Viewer   Position: 24604372-24604488 (bp)   D20S558E Sequence Map: Chr 20|Celera Map Viewer   Position: 24721316-24721432 (bp)   stSG3002 NCBI RH Map: Chr 20 Map Viewer   Position: 205.4 (cR)   Lod score: 1.05   stSG3002 GeneMap99-GB4 Map: Chr 20 Map Viewer   Position: 126.96 (cR3000)   Lod score: 3.00   Reference Interval: D20S182-D20S106 Electronic PCR results RefSeq mRNA (1) NM_024893.1 2266 .. 2382 (117 bp)     mRNA (2) AK024282.1 2266 .. 2382 (117 bp)   BC030637.1 1768 .. 1884 (117 bp)     Genomic (5 of 8)[Show All Hits] G07279.1 107 .. 223 (117 bp)   AL049594.4 53568 .. 53684 (117 bp)   CH003467.1 24575519 .. 24575635 (117 bp)   CH003515.1 26086350 .. 26086466 (117 bp)   CH471133.3 24578492 .. 24578608 (117 bp)     ESTs (5 of 34)[Show All Hits] Z38996.1 107 .. 223 (117 bp)   F01451.1 60 .. 176 (117 bp)   H05223.1 66 .. 183 (118 bp)   N93994.1 121 .. 238 (118 bp)   W77990.1 107 .. 223 (117 bp)     Whole Genome Shotgun sequences (4) AADD01168617.1 4737 .. 4853 (117 bp)   AADC01141534.1 112702 .. 112818 (117 bp)   AADB02401922.1 678162 .. 678278 (117 bp)   ABBA01048734.1 54404 .. 54520 (117 bp)        Macaca fascicularis   Polymorphism info:   Cross References UniGene Mfa.8734 Macaca fascicularis brain cDNA clone: QorA-12262, similar to human chromosom...    Macaca mulatta Name: D20S558E Polymorphism info:   Cross References Gene GeneID: 704737   Symbol: LOC704737   Description: hypothetical protein LOC704737   Position:   UniGene Mmu.118 Hypothetical protein LOC704737 Mapping Information D20S558E Sequence Map: Chr 10 Map Viewer   Position: 57879876-57879992 (bp)    Pan troglodytes Name: D20S558E Polymorphism info:   Cross References Gene GeneID: 740833   Symbol: LOC740833   Description: hypothetical protein LOC740833   Position:   Mapping Information D20S558E Sequence Map: Chr 20 Map Viewer   Position: 24996177-24996293 (bp) Electronic PCR results RefSeq mRNA (2) XM_001148167.1 1724 .. 1840 (117 bp)   XM_001148244.1 1783 .. 1899 (117 bp)     Genomic (1) CM000334.2 24996177 .. 24996293 (117 bp)     Whole Genome Shotgun sequences (2) AADA01042609.1 4987 .. 5103 (117 bp)   AACZ02189926.1 4811 .. 4927 (117 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement