PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:67119 Links SHGC-30575 Homo sapiens chromosome 3, locus KIF9 Pan troglodytes chromosome 3, loci KIF9 and LOC741902 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TCCTGTCCCTGCATATAAGACA Reverse primer: GACCCAGCACAGAGAACACA PCR product size: 121 (bp), Homo sapiens GenBank Accession: F09639 G24313    Homo sapiens Name: SHGC-30575 Also known as: EST131887 SGC30575 WI-30575 Polymorphism info:   Cross References Gene GeneID: 64147   Symbol: KIF9   Description: kinesin family member 9   Position: 3p21.31 UniGene Hs.373947 Kinesin family member 9 Mapping Information SHGC-30575 Sequence Map: Chr 3|Celera Map Viewer   Position: 47208210-47208330 (bp)   SHGC-30575 Sequence Map: Chr 3 Map Viewer   Position: 47244917-47245037 (bp)   SHGC-30575 Sequence Map: Chr 3|HuRef Map Viewer   Position: 47312936-47313056 (bp)   SHGC-30575 NCBI RH Map: Chr 3 Map Viewer   Position: 474.3 (cR)   Lod score: 1.36   SHGC-30575 TNG Map: Chr 3 Map Viewer   Position: 29654 (cR50000)   Lod score: 9   Reference Interval: 73   SHGC-30575 Stanford-G3 Map: Chr 3 Map Viewer   Position: 2054 (cR10000)   Lod score: F   Reference Interval: 28   SGC30575 Whitehead-RH Map: Chr 3 Map Viewer   Position: 184.5 (cR3000)   Lod score: P2.87   SHGC-30575 GeneMap99-G3 Map: Chr 3 Map Viewer   Position: 1952 (cR10000)   Lod score: F   Reference Interval: D3S3582-D3S1588   SGC30575 GeneMap99-GB4 Map: Chr 3 Map Viewer   Position: 154.52 (cR3000)   Lod score: 3.00   Reference Interval: D3S3582-D3S1588 Electronic PCR results RefSeq mRNA (2) NM_182902.2 2591 .. 2711 (121 bp)   NM_022342.3 2348 .. 2468 (121 bp)     mRNA (3) AF311212.1 2348 .. 2468 (121 bp)   BC030657.2 2591 .. 2711 (121 bp)   AK292547.1 2534 .. 2654 (121 bp)     Genomic (5 of 8)[Show All Hits] G24313.1 28 .. 148 (121 bp)   AC104447.2 75478 .. 75598 (121 bp)   CH003450.1 47411133 .. 47411253 (121 bp)   CH003498.1 17395878 .. 17395998 (121 bp)   CH471055.1 47208210 .. 47208330 (121 bp)     ESTs (5 of 15)[Show All Hits] F09639.1 28 .. 148 (121 bp)   AA757997.1 30 .. 150 (121 bp)   AA994522.1 32 .. 152 (121 bp)   AI638287.1 33 .. 153 (121 bp)   AI655206.1 33 .. 153 (121 bp)     Whole Genome Shotgun sequences (4) AADD01032449.1 27079 .. 27199 (121 bp)   AADC01026505.1 26639 .. 26759 (121 bp)   AADB02003519.1 4168 .. 4288 (121 bp)   ABBA01024700.1 4048 .. 4168 (121 bp)        Pan troglodytes Name: SHGC-30575 Polymorphism info:   Cross References Gene GeneID: 741902   Symbol: LOC741902   Description: hypothetical protein LOC741902   Position:   Gene GeneID: 741941   Symbol: KIF9   Description: kinesin family member 9   Position:   Mapping Information SHGC-30575 Sequence Map: Chr 3 Map Viewer   Position: 48284098-48284218 (bp) Electronic PCR results RefSeq mRNA (1) XR_020636.1 2491 .. 2611 (121 bp)     Genomic (1) CM000317.1 48284098 .. 48284218 (121 bp)     Whole Genome Shotgun sequences (2) AADA01168502.1 1085 .. 1205 (121 bp)   AACZ02035818.1 1068 .. 1188 (121 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement