refSNP ID: rs1804904 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 89/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: Not available Clinical Association: unknown HGVS Names NM_005341.1:c.1968C>T NP_005332.1:p.P656P NT_021937.18:g.1186539C>T NT_021937.18:g.1186540C>T Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss2425745 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs1804904 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss2425745 HGBASE|SNP000013459 fwd/B C/T agggcggcctggcctcccagctccc ggccagagactgtgtgcagaggaga 11/07/00 10/10/03 89 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs1804904|allelePos=26|totalLen=51|taxid=9606|snpclass=1|alleles='C/T'|mol=cDNA|build=89 AGGGCGGCCT GGCCTCCCAG CTCCC Y GGCCAGAGAC TGTGTGCAGA GGAGA   GeneView GeneView via analysis of contig annotation: KLHL21 kelch-like 21 (Drosophila) View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_021937->NM_014851 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_021937->NM_014851->NP_055666 1186540 reverse 3' near gene GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs1804904 maps exactly once on NCBI human chromosome 1 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 1 NW_923572.1 3332357 5763031 plus C alt_assembly_1 Celera Celera view 25 1 NW_001838523.1 786600 5797100 plus C alt_assembly_8 HuRef HuRef view 25 1 NT_021937.18 1186540 6571760 plus C ref_assembly reference reference view 25   NCBI Resource Links Submitter-Referenced GenBank L16896 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank HTGS Finished: GenBank mRNA: NM_005341.1 AL031447.4 AL591866.13 AF318381.1 AK290156.1 BC013573.2 L16896.1 UniGene Cluster ID 502330   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .