Porcine jejunal intestinal tissue was obtained from 5-9 week old Yorkshire pigs as described previously (Green et al., 2003). Jejunal segments containing a Peyer's patch were stripped of the underlying smooth muscle layer and stored in RNAlater (Ambion, Inc., Austin, TX) immediately or mounted in an Ussing flux chamber (Green et al., 2003). Treatments were added to the luminal side of the Ussing chamber in both the presence and absence of 50 µM cycloheximide and incubated for 3 hours. Stimulation conditions consisted of (1) log phase Salmonella choleraesuis vaccine strain SC-54 (Roof and Doitchinoff, 1995) at an initial bacterial concentration of 2.7 x 104 CFU/ml; (2) 1 µg/ml lipopolysaccharide and 50 ng/ml cholera toxin (CT+LPS); (3) 100 nM phorbol myristate acetate, 1 mM 8-bromo-cyclic AMP and 5 µg/ml concanavalin A (PBC); and (4) incubated with no stimulation (normal). After the 3 hour incubation, tissues were removed, the region of tissue containing the Peyer's patch was excised and was stored in RNAlater (Ambion, Inc., Austin, TX) at Ð20¡C. RNA was isolated from all Peyer's patches using Qiagen RNeasy kits (Qiagen Inc., Valencia, CA) and examined for quality using the RNA 6000 Nano LabChip Kit on an Agilent 2100 bioanalyzer system (Agilent Technologies, Palo Alto, CA). RNA from all normal tissues were pooled in equal amounts and used to create the normal tissue library. RNA from all immune stimulated tissues (Salmonella infection, CT+LPS, and PBC, with and without cycloheximide) were pooled in equal amounts and used to create the immune stimulated tissue library. Libraries were created in the pCMV¥Sport 6 plasmid using the SuperScript Plasmid System with Gateway Technology (Invitrogen Corporation, Carlsbad, CA) with a modified Not I d(T) primer (5' GACTAGTTCTAGATCGCGAGCGGCCGCCT17VN 3'). The subtracted library was created by combining the normal and immune stimulated libraries and by subtracting porcine fibroblast RNA. cRNA was created from each of the subtracted, normal, and immune stimulated libraries following the MAXIscript in vitro transcription kit protocol (Ambion Inc., Austin, TX). The above cRNA's (200 ng) or isolated total RNA (10 ug) were used as templates for the reverse transcription and amino allyl coupling reaction. Either the SuperScript Indirect cDNA Labeling System (Invitrogen Corporation, Carlsbad, CA) was used for the reverse transcription reaction and clean-up steps or a similar homemade procedure was performed. The microarray chips were incubated at 63¡C for 5 to 16 hours, washed, dried, and scanned using a ScanArray 5000 (GSI Lumonics, Billerica, MA). Images were quantified with QuantArray software version 3 (PerkinElmer, Boston, MA) using the adaptive method to calculate the mean spot intensity and mean background intensity. Sample_dye_swap: Immune Stim. (Cy3)/ Normal (Cy5) Keywords = jejunal Peyer's patch Keywords = pig Keywords = small intestine Lot batch =
LOWESS normalized natural log ratio of means defined by ch2/ch1.
NormCH2
LOWESS normalized CH2 intensity
NormCH1
LOWESS normalized CH1 intensity
FLAG
Denotes which spots met our filtering criterion. A value of 1 means that the spot was excluded from analysis
ch1 Intensity
ch1 (Cy3) mean fluorescence intensity
ch1 Background
ch1 (Cy3) background mean fluorescence intensity
ch1 Intensity Std Dev
ch1 (Cy3) fluorescence intensity standard deviation
ch1 Background Std Dev
ch1 (Cy3) background fluorescence intensity standard deviation
ch1 Diameter
2 x (area/pi)^ 1/2
ch1 Area
Number of spot pixels
ch1 Footprint
The distance between the expected position of a spot and its actual measured position.
ch1 Circularity
4pi x area/ (perimeter)^2
ch1 Spot Uniformity
1-(I(MAX)-I(MIN)/Range), where I(MAX) and I(MIN) are the maximum and minimum intensity value of the pixels within a spot, respectively, after 2% of the pixels with the highest and lowest intensity had been excluded
ch1 Bkg. Uniformity
See description for spot uniformity. Calculated with background pixel values.
ch1 Signal Noise Ratio
spot intensity/ standard deviation of the background intensity
ch1 Confidence
Overall confidence score, calculated by combining the confidence scores by the product method: (c1 x c2 x. . . x cn)^1/n, where c1, c2, etc. are confidence scores for each spot quality parameter.
ch2 Intensity
ch2 (Cy5) mean fluorescence intensity
ch2 Background
ch2 (Cy5) background mean fluorescence intensity
ch2 Intensity Std Dev
ch2 (Cy5) fluorescence intensity standard deviation
ch2 Background Std Dev
ch2 (Cy5) background fluorescence intensity standard deviation
ch2 Diameter
2 x (area/pi)^ 1/2
ch2 Area
Number of spot pixels
ch2 Footprint
The distance between the expected position of a spot and its actual measured position.
ch2 Circularity
4pi x area/(perimeter)^2
ch2 Spot Uniformity
1-(I(MAX)-I(MIN)/Range), where I(MAX) and I(MIN) are the maximum and minimum intensity value of the pixels within a spot, respectively, after 2% of the pixels with the highest and lowest intensity had been excluded
ch2 Bkg. Uniformity
See description for spot uniformity. Calculated with background pixel values.
ch2 Signal Noise Ratio
spot intensity/ standard deviation of the background intensity
ch2 Confidence
Overall confidence score, calculated by combining the confidence scores by the product method: (c1 x c2 x. . . x cn)^1/n, where c1, c2, etc. are confidence scores for each spot quality parameter.
