PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:174541 Links SHGC-145385 Homo sapiens chromosome 5, locus MARCH6 Macaca mulatta chromosome 6, locus LOC716330 Pan troglodytes chromosome 5, locus MARCH6 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TTTTTCCCCCTTGGTCTTTACTC Reverse primer: ACCAGTTTCCCTGAGCAGAAAG PCR product size: 272 (bp), Homo sapiens    Homo sapiens Name: SHGC-145385 Polymorphism info:   Cross References Gene GeneID: 10299   Symbol: MARCH6   Description: membrane-associated ring finger (C3HC4) 6   Position: 5p15.2 Mapping Information SHGC-145385 Sequence Map: Chr 5|HuRef Map Viewer   Position: 10397452-10397723 (bp)   SHGC-145385 Sequence Map: Chr 5|Celera Map Viewer   Position: 10451475-10451746 (bp)   SHGC-145385 Sequence Map: Chr 5 Map Viewer   Position: 10466343-10466614 (bp)   SHGC-145385 TNG Map: Chr 5 Map Viewer   Position: 4565 (cR50000)   Lod score: 14.3   Reference Interval: 12 Electronic PCR results Genomic (5 of 7)[Show All Hits] AC092336.2 95863 .. 96134 (272 bp)   CH003452.1 10547096 .. 10547367 (272 bp)   CH003500.1 11156471 .. 11156742 (272 bp)   CH471102.2 9553907 .. 9554178 (272 bp)   CM000256.1 10451475 .. 10451746 (272 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AC011135.3 63024 .. 63295 (272 bp)   AC025184.6 102683 .. 102954 (272 bp)   AC105412.1 129892 .. 130163 (272 bp)     Whole Genome Shotgun sequences (4) AADD01055688.1 42161 .. 42432 (272 bp)   AADC01048819.1 52469 .. 52740 (272 bp)   AADB02008332.1 114453 .. 114724 (272 bp)   ABBA01020601.1 52803 .. 53074 (272 bp)        Macaca mulatta Name: SHGC-145385 Polymorphism info:   Cross References Gene GeneID: 716330   Symbol: LOC716330   Description: similar to membrane-associated ring finger (C3HC4) 6   Position:   Mapping Information SHGC-145385 Sequence Map: Chr 6 Map Viewer   Position: 10344978-10345250 (bp)    Pan troglodytes Name: SHGC-145385 Polymorphism info:   Cross References Gene GeneID: 461722   Symbol: MARCH6   Description: membrane-associated ring finger (C3HC4) 6   Position:   Mapping Information SHGC-145385 Sequence Map: Chr 5 Map Viewer   Position: 10601816-10602087 (bp) Electronic PCR results Genomic (1) CM000319.1 10601816 .. 10602087 (272 bp)     Whole Genome Shotgun sequences (2) AADA01108740.1 22596 .. 22867 (272 bp)   AACZ02058123.1 1395 .. 1666 (272 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement