refSNP ID: rs2275467 Organism: human (Homo sapiens) Molecule Type: Genomic Created/Updated in build: 100/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: A/C Ancestral Allele: C Clinical Association: unknown HGVS Names NM_007259.3:c.822+112G>T NT_004487.18:g.544025G>T Links , Linkout SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss3211573 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs2275467 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss3211573 YUSUKE|IMS-JST071657 fwd/T A/C ccttcagaggcagtttatgcacaggatgcc ctatcatcctttcacatgaaatcccatgcc 09/05/01 10/10/03 100 Genomic unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs2275467|allelePos=61|totalLen=121|taxid=9606|snpclass=1|alleles='A/C'|mol=Genomic|build=100 AAAGGGTCAG AATCCAAGTC TTCTGCCTTC CCTTCAGAGG CAGTTTATGC ACAGGATGCC M CTATCATCCT TTCACATGAA ATCCCATGCC TGCCCCTATA CTAACAAGCC AATATTGATC   GeneView GeneView via analysis of contig annotation: VPS45 vacuolar protein sorting 45 homolog (S. cerevisiae) View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_004487->NM_007259 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_004487->NM_007259->NP_009190 544025 forward intron GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs2275467 maps exactly once on NCBI human chromosome 1 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 1 NW_001838529.1 251393 121433562 minus G alt_assembly_8 HuRef HuRef view 60 1 NW_925683.1 206248 123169422 minus G alt_assembly_1 Celera Celera view 60 1 NT_004487.18 544025 148320294 minus G ref_assembly reference reference view 60   NCBI Resource Links Submitter-Referenced GenBank AL358353.6 dbSNP Blast Analysis GenBank HTGS Finished: GenBank HTGS Draft: AL358073.24 AL358353.11   Population Diversity Sample Ascertainment Genotypes Alleles ss# Population Individual Group Chrom. Sample Cnt. Source HWP A C ss3211573 JBIC-allele 1492 AF 0.025 0.975 Summary Average Het.+/- std err: Individual Count Founders Count Individual Overlap Genotype Conflict 0.050+/-0.150 0 0 0 0   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .