PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:25781 Links RH77931 Homo sapiens chromosome 16, locus HPR Pan troglodytes chromosome 16 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CAGAGTTACCTGGCCACCAT Reverse primer: TTGTGAGGAGACACATCCCA PCR product size: 144 (bp), Homo sapiens    Homo sapiens Name: RH77931 Also known as: stSG39853 Polymorphism info:   Cross References Gene GeneID: 3250   Symbol: HPR   Description: haptoglobin-related protein   Position: 16q22.1 Mapping Information RH77931 Sequence Map: Chr 16|Celera Map Viewer   Position: 56412856-56412999 (bp)   RH77931 Sequence Map: Chr 16|HuRef Map Viewer   Position: 57865568-57865711 (bp)   RH77931 Sequence Map: Chr 16 Map Viewer   Position: 70656238-70656381 (bp)   stSG39853 NCBI RH Map: Chr 16 Map Viewer   Position: 547.2 (cR)   Lod score: 1.25   stSG39853 GeneMap99-GB4 Map: Chr 16 Map Viewer   Position: 427.18 (cR3000)   Lod score: 0.26   Reference Interval: D16S3031-D16S3139 Electronic PCR results Genomic (5 of 8)[Show All Hits] AC004682.1 181770 .. 181913 (144 bp)   AC009087.4 52397 .. 52540 (144 bp)   CH003463.1 53019726 .. 53019869 (144 bp)   CH003511.1 57052340 .. 57052483 (144 bp)   CH471166.2 904994 .. 905137 (144 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC009160.5 89190 .. 89333 (144 bp)     ESTs (1) N39323.1 360 .. 503 (144 bp)     Whole Genome Shotgun sequences (4) AADD01149905.1 1013 .. 1156 (144 bp)   AADC01126846.1 6225 .. 6368 (144 bp)   AADB02017649.1 807943 .. 808086 (144 bp)   ABBA01016797.1 27661 .. 27804 (144 bp)        Pan troglodytes Name: RH77931 Polymorphism info:   Mapping Information RH77931 Sequence Map: Chr 16|NW_001226817.1 Map Viewer   Position: 8162-8305 (bp) Electronic PCR results BAC-ends (1) AG139393.1 238 .. 382 (145 bp)     Whole Genome Shotgun sequences (2) AADA01146021.1 7563 .. 7706 (144 bp)   AACZ02167177.1 513 .. 656 (144 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement