PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:80607 Links RH78821 Homo sapiens chromosome 12, locus NCOR2 Pan troglodytes chromosome 12, locus NCOR2 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TTGTCCCCAGAGCTCAGG Reverse primer: CTTCAGCAAGTGTTAGGGACG PCR product size: 130 (bp), Homo sapiens    Homo sapiens Name: RH78821 Also known as: stSG42540 Polymorphism info:   Cross References Gene GeneID: 9612   Symbol: NCOR2   Description: nuclear receptor co-repressor 2   Position: 12q24 Mapping Information RH78821 Sequence Map: Chr 12|HuRef Map Viewer   Position: 121831661-121831790 (bp)   RH78821 Sequence Map: Chr 12 Map Viewer   Position: 123434771-123434900 (bp)   RH78821 Sequence Map: Chr 12|Celera Map Viewer   Position: 124469570-124469699 (bp)   stSG42540 NCBI RH Map: Chr 12 Map Viewer   Position: 776.8 (cR)   Lod score: 3.52   stSG42540 GeneMap99-GB4 Map: Chr 12 Map Viewer   Position: 479.55 (cR3000)   Lod score: 0.20   Reference Interval: D12S366-D12S340 Electronic PCR results Genomic (5 of 8)[Show All Hits] G27367.1 101 .. 230 (130 bp)   AC073916.41 99531 .. 99660 (130 bp)   CH003459.1 122168484 .. 122168613 (130 bp)   CH003507.1 131032855 .. 131032984 (130 bp)   CH471054.1 72093399 .. 72093528 (130 bp)     Working Draft phase 1 (from GenBank HTGS division) (1) AC027706.2 119525 .. 119654 (130 bp)     ESTs (5 of 6)[Show All Hits] H85010.1 101 .. 230 (130 bp)   H85886.1 99 .. 227 (129 bp)   W92424.1 112 .. 242 (131 bp)   W96141.1 147 .. 276 (130 bp)   AA018872.1 112 .. 240 (129 bp)     Whole Genome Shotgun sequences (4) AADD01129041.1 28604 .. 28733 (130 bp)   AADC01110861.1 37345 .. 37474 (130 bp)   AADB02015740.1 44758 .. 44887 (130 bp)   ABBA01060380.1 29691 .. 29820 (130 bp)        Pan troglodytes Name: RH78821 Polymorphism info:   Cross References Gene GeneID: 467150   Symbol: NCOR2   Description: similar to nuclear receptor co-repressor 2   Position:   Mapping Information RH78821 Sequence Map: Chr 12 Map Viewer   Position: 126275340-126275469 (bp) Electronic PCR results Genomic (2) CM000326.1 126275340 .. 126275469 (130 bp)   AC192156.4 7480 .. 7609 (130 bp)     Whole Genome Shotgun sequences (2) AADA01014635.1 424 .. 553 (130 bp)   AACZ02139241.1 40247 .. 40376 (130 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement