Join Evaluation Legend

Serious alignment problem, requires review. (details...)
- Zero, or more than one, overlaps
- Half dove-tail >50 bp
- Alignment identity <98%
- Alignment length <100 bp
- >2 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Minor alignment problem. (details...)
- Exactly one overlap
- Half dove-tail >0 bp and <=50bp
- Alignment identity <99.1%
- Alignment length <2000 bp
- >0 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Excellent alignment, meets all defined criteria. (details...)
- Exactly one RuleInfo
- Half dove-tail <=0 bp
- Alignment identity >=99.1%
- Alignment length >=2000 bp
- <=0 gaps, each gap >25 bp, not marked as an SSR
- <=0 gaps, each gap >50 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, marked as an SSR
Certificate submitted, not yet approved.
Certificate submitted and approved.
Valid, contained clone
Join not evaluated due to one accession not being finished.

Curator Links

Add/Update certificate

Alignment for AL807778.10 and BX682541.5

AL807778.10 Mouse DNA sequence from clone RP23-198G1 on chromosome 2 Contains the 3' end of a novel gene, protein regulator of cytokinesis 1 (Prc1) pseudogene, the Sephs1 gene for selenophosphate synthetase 1, the 5' end of the Phyh gene for phytanoyl-CoA hydroxylase and a CpG island, complete sequence [htgs_phase3]

Length: 203,518 bp

BX682541.5 Mouse DNA sequence from clone RP23-349P20 on chromosome 2 Contains the 3' end of the Phyh gene for phytanoyl-CoA hydroxylase, a human ribosomal protein L36a-like (Rpl36a) pseudogene, a diazepam binding inhibitor (Dbi) pseudogene, a human ribosomal protein S28 (RPS28) pseudogene and the 5' end of a novel gene, complete sequence [htgs_phase3]

Length: 55,982 bp

Alignment Summary

Join evaluation: yellow (alignment length < 2000)

Alignment count: 1

Go to Endhit Table

Alignment 1
Align ID: 15493
Total Length: 2000
Aligned Length: 1999
Percent Identity: 100
Number of Gaps: 1
Number of Mismatches: 0
Source: CtgOverlap Seq-Align
Valid Switchpoint: true (A)

Alignment 1 of 1

 Mismatches = 0, Gaps = 1, Length = 2000
 Percent identity = 100%
 Score = 3949 bits (1992), Expect = 0
  1 BAC and 8 Fosmid bridging clones.
  1 BAC and 8 Fosmid concordant clones.
  0 BAC and 0 Fosmid discordant clones.

AL807778.10 >201520  cctctgtattttgttttatatgatttttatcctattataataagtatgcccacagtattc 201579 
BX682541.5  >1       ............................................................ 60     

AL807778.10 >201580  tgcccttcatttttaacatctattgtacagatataattccttggttaatatttttttcag 201639 
BX682541.5  >61      ............................................................ 120    

AL807778.10 >201640  taatacacatttttggtgactgtacctatgttttggacttaacactctaaactttgtcct 201699 
BX682541.5  >121     ............................................................ 180    

AL807778.10 >201700  cactacttcattaaagcaatacacatagaaatgttgagttgaaaagtacaaatgcaggca 201759 
BX682541.5  >181     ............................................................ 240    

AL807778.10 >201760  ggctgtgggagtacatatctctggtccctttactcaagaagcagaagcaggcagatctct 201819 
BX682541.5  >241     ............................................................ 300    

AL807778.10 >201820  gagttcaaggctagccttgcctacctggcaagttccaggccagttagatttggatagtaa 201879 
BX682541.5  >301     ............................................................ 360    

AL807778.10 >201880  gacagattcttggtatgaaagacctccgtggggataaccccacccgagtcaagagatagc 201939 
BX682541.5  >361     ............................................................ 420    

AL807778.10 >201940  gtgcacccaaagaatcaagagagaccatcttgacgtaaacacacaaggtagtttaatgac 201999 
BX682541.5  >421     ............................................................ 480    

AL807778.10 >202000  ggagctccgggctacacgtatctcacgcaggagacagaggtgttgaccctaaggctcaaa 202059 
BX682541.5  >481     ............................................................ 540    

AL807778.10 >202060  agttaggggtttatataggaaaggagtggggggataggggaaattggcacagttacacac 202119 
BX682541.5  >541     ............................................................ 600    

AL807778.10 >202120  aagtgggcagtttaaacatcagtgagcagtatgtgacagtaactctaaatggagggtgtt 202179 
BX682541.5  >601     ............................................................ 660    

AL807778.10 >202180  tatcttggttggcagggcatctggctaagctcaaaccatatcagcaggtagcccattact 202239 
BX682541.5  >661     ............................................................ 720    

AL807778.10 >202240  catctgagattgtccttgccttttttttttttttttttttttttttatctcagtggctag 202299 
BX682541.5  >721     ............................................................ 780    

AL807778.10 >202300  ttggttcctgggatgactttacagcctttgtgtccacccgcccgactctcttatctttat 202359 
BX682541.5  >781     ............................................................ 840    

AL807778.10 >202360  ggctttaagtctgtaaaccttctgactagggccttgaataaaccttctggctagggcttt 202419 
BX682541.5  >841     ............................................................ 900    

AL807778.10 >202420  gaagccttgaatttagttttctttctttcaggtatactgctagcttgtaatttaaaatgg 202479 
BX682541.5  >901     ............................................................ 960    

AL807778.10 >202480  ggacttacttggaggctcttttttttttttttt-ctttaggtatactctggataataatg 202538 
BX682541.5  >961     .................................t.......................... 1020   

AL807778.10 >202539  tcctcaccctggagcagagaaaattttatgaagaaaatgggtttctcgtcattaagaatc 202598 
BX682541.5  >1021    ............................................................ 1080   

AL807778.10 >202599  tggtatctgatgatgacattcaacgttttcggtataatacttctgtttatgattttacaa 202658 
BX682541.5  >1081    ............................................................ 1140   

AL807778.10 >202659  aaagctacattatattgcgtctcagccttttggctaagatcaagtgcaaaaagctgcatt 202718 
BX682541.5  >1141    ............................................................ 1200   

AL807778.10 >202719  acatgaatgcaatggtaacacaggtttagactagcttctgcgtgttcacagtttatgtgt 202778 
BX682541.5  >1201    ............................................................ 1260   

AL807778.10 >202779  gtgggttccaactcatgcatgtggaggtcctaggacaaccgcactgtctgtctgtcccct 202838 
BX682541.5  >1261    ............................................................ 1320   

AL807778.10 >202839  ttgttctccctgcttgggacaaggtctcttttttgtttgctgttgttattcactggcctg 202898 
BX682541.5  >1321    ............................................................ 1380   

AL807778.10 >202899  agagcttcctgtagcccttctgcctctatgtatatcttacagaagtaatgaagggaatat 202958 
BX682541.5  >1381    ............................................................ 1440   

AL807778.10 >202959  agctccacactctcacatctgcctttctgtactcctgccttgagtgagccagcaggtgct 203018 
BX682541.5  >1441    ............................................................ 1500   

AL807778.10 >203019  tgactcactaagctgcctccctagatgagttcagagattcttttttaaggatgatttgtt 203078 
BX682541.5  >1501    ............................................................ 1560   

AL807778.10 >203079  tgggagtgtttagaaatggaaactcaagtgccagactctctggcttgggtcttagtccta 203138 
BX682541.5  >1561    ............................................................ 1620   

AL807778.10 >203139  cccgtaatgtgcttgggcaatctgcgtatgcctcagtttccctgttcttaaaatggggca 203198 
BX682541.5  >1621    ............................................................ 1680   

AL807778.10 >203199  ttttgagtctactggtgtcttcgtgttgtgggaacaaaataagggaagtcagtgtcaggc 203258 
BX682541.5  >1681    ............................................................ 1740   

AL807778.10 >203259  tctcagaccagggttgacaccccagaggtactacagaaaagtttgcttttccaatttttt 203318 
BX682541.5  >1741    ............................................................ 1800   

AL807778.10 >203319  tgcattagggatgttcaaccttcaacatcaaataaatctcactgccaaatctaaagcccc 203378 
BX682541.5  >1801    ............................................................ 1860   

AL807778.10 >203379  cctgagtgacaacatggaacaatagctggaaaacccctcacgcaacctctcgtgaagggg 203438 
BX682541.5  >1861    ............................................................ 1920   

AL807778.10 >203439  tgaagtcaaaataggcaaaaatgatgcataagatgcctttaggcctgtgtacaggttgta 203498 
BX682541.5  >1921    ............................................................ 1980   

AL807778.10 >203499  acggaaacacaagtgaattc 203518 
BX682541.5  >1981    .................... 2000

Switch Points

Type	Point1	Point2	Orient1	Orient2	Curator	Comment	Time
A	203518	2001	+	+	chenhc	Taxid 10090 chrom 2 Reference assembly	2008-11-20 16:49:35.253

Events

Id	Type	Date	Whodid	Comment
23328	ImportOldDb	09/04/2005 14:29:00	f_old_db
23329	ReSetShortOvlp	09/04/2008 10:31:48	dbo
165707	CreateSwitchPt	11/20/2008 16:49:35	chenhc	tpf_builder 1.6 Toolkit wrapper version: built Nov 19 2008 using /netopt/ncbi_tools64/c++.by-date/20081119/GCC401-Release64/lib

BAC Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
C3H-109B13				AL807778.10	99.86%	pos 34235 (F+)
C3H-109I18				AL807778.10	99.17%	pos 97913 (F-)
C3H-195K23	BX682541.5	100%	pos 26760 (R+)
C3H-235C15	BX682541.5	99.2%	pos 28418 (R-)
C3H-247C5				AL807778.10	99.19%	pos 139825 (F+)
CH29-114L17				AL807778.10	99.09%	pos 130843 (F+)
CH29-516F24				AL807778.10	99.49%	pos 120965 (F+)
CH29-538I18	BX682541.5	99.1%	pos 40409 (R-)	AL807778.10	99.87%	pos 82037 (F+)
CH29-549N23				AL807778.10	100%	pos 17246 (F-)
CH29-7I18	AL807778.10	99.53%	pos 34697 (R+)
CH29-7O19	AL807778.10	99.42%	pos 26553 (R+)
RP23-126D13	AL807778.10	99.34%	pos 46293 (R-)
RP23-272I15	AL807778.10	99.45%	pos 47916 (R-)
RP24-166M5	AL807778.10	99.11%	pos 161292 (R+)
RP24-325M13	AL807778.10	100%	pos 150518 (R-)
RP24-335L3				AL807778.10	99.24%	pos 4263 (F-)
RP24-73K4				AL807778.10	99.6%	pos 51157 (F-)

Fosmid Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
WI1-1006I10	AL807778.10	100%	pos 93526 (R+)	AL807778.10	100%	pos 130129 (F-)
WI1-1007G3	AL807778.10	99.83%	pos 178625 (R+)	BX682541.5	100%	pos 17989 (F-)
WI1-1049E24	AL807778.10	99.14%	pos 63249 (R+)	AL807778.10	99.62%	pos 103121 (F-)
WI1-1074J13	AL807778.10	99.82%	pos 24266 (R-)
WI1-1111C4				AL807778.10	99.85%	pos 9952 (F-)
WI1-1114B12	AL807778.10	99.54%	pos 70910 (R+)	AL807778.10	99.85%	pos 113539 (F-)
WI1-1169M3	AL807778.10	99.73%	pos 94941 (R+)	AL807778.10	100%	pos 139654 (F-)
WI1-1322G14	AL807778.10	99.81%	pos 74646 (R+)	AL807778.10	99.82%	pos 112337 (F-)
WI1-1322O19	AL807778.10	99.71%	pos 74637 (R+)	AL807778.10	99.83%	pos 112340 (F-)
WI1-132I8	AL807778.10	100%	pos 183446 (R-)	AL807778.10	100%	pos 146355 (F+)
WI1-1336C21				AL807778.10	100%	pos 121155 (F+)
WI1-1406D8	AL807778.10	100%	pos 158521 (R-)	AL807778.10	99.64%	pos 118470 (F+)
WI1-1434J10	AL807778.10	99.82%	pos 41913 (R+)	AL807778.10	99.5%	pos 83555 (F-)
WI1-1434J10				AL807778.10	99.5%	pos 83579 (F-)
WI1-1484I20	AL807778.10	100%	pos 112158 (R-)
WI1-152I3	BX682541.5	99.65%	pos 37889 (R-)	AL807778.10	99.83%	pos 201340 (F+)
WI1-1550J20	AL807778.10	100%	pos 151691 (R-)	AL807778.10	100%	pos 114139 (F+)
WI1-1583B15	AL807778.10	99.37%	pos 40839 (R+)
WI1-1589O21				BX682541.5	100%	pos 45166 (F+)
WI1-1590O5	AL807778.10	99.47%	pos 33066 (R-)
WI1-1610M5	AL807778.10	99.69%	pos 29029 (R+)	AL807778.10	100%	pos 67295 (F-)
WI1-1629F18	AL807778.10	100%	pos 195769 (R-)	AL807778.10	100%	pos 195842 (F-)
WI1-164D7	AL807778.10	99.55%	pos 29022 (R+)	AL807778.10	100%	pos 67284 (F-)
WI1-1779A19				AL807778.10	100%	pos 122553 (F+)
WI1-1779H1	AL807778.10	100%	pos 158712 (R-)	AL807778.10	100%	pos 122562 (F+)
WI1-1800C15	AL807778.10	100%	pos 195771 (R+)	BX682541.5	99.84%	pos 37865 (F-)
WI1-1853M14	AL807778.10	100%	pos 87498 (R-)	AL807778.10	99.85%	pos 47623 (F+)
WI1-1876F12	AL807778.10	100%	pos 41690 (R+)	AL807778.10	100%	pos 82004 (F-)
WI1-189P8	BX682541.5	99.06%	pos 17437 (R+)
WI1-1905J13	BX682541.5	99.67%	pos 45435 (R-)
WI1-1932L5	AL807778.10	99.42%	pos 58288 (R-)
WI1-1934G4				AL807778.10	99.83%	pos 15113 (F-)
WI1-1961L14	AL807778.10	100%	pos 97483 (R+)	AL807778.10	99.84%	pos 139226 (F-)
WI1-1969J6	AL807778.10	100%	pos 61078 (R-)	AL807778.10	99.85%	pos 22024 (F+)
WI1-1971J8	AL807778.10	100%	pos 159796 (R+)
WI1-1975J21	AL807778.10	99.68%	pos 143231 (R-)	AL807778.10	100%	pos 103167 (F+)
WI1-2006J6	AL807778.10	100%	pos 3315 (R+)	AL807778.10	99.55%	pos 44596 (F-)
WI1-2011G6	AL807778.10	100%	pos 197387 (R+)	BX682541.5	100%	pos 33901 (F-)
WI1-2024D23	AL807778.10	100%	pos 54096 (R+)	AL807778.10	100%	pos 95743 (F-)
WI1-2035G23	AL807778.10	100%	pos 198091 (R+)	BX682541.5	99.26%	pos 36209 (F-)
WI1-206I19	AL807778.10	100%	pos 195932 (R+)	BX682541.5	100%	pos 34037 (F-)
WI1-209E11	AL807778.10	99.83%	pos 52295 (R+)	AL807778.10	99.8%	pos 98391 (F-)
WI1-2145L24	BX682541.5	100%	pos 50048 (R+)
WI1-2163D19	AL807778.10	100%	pos 176308 (R+)	BX682541.5	99.72%	pos 14435 (F-)
WI1-2170C21	AL807778.10	100%	pos 34270 (R+)	AL807778.10	99.69%	pos 76780 (F-)
WI1-2210O21				BX682541.5	100%	pos 47611 (F+)
WI1-2228H12				AL807778.10	99.03%	pos 150508 (F+)
WI1-2232O5	AL807778.10	100%	pos 26975 (R+)	AL807778.10	99.71%	pos 68495 (F-)
WI1-2300E10	AL807778.10	100%	pos 70874 (R+)	AL807778.10	99.7%	pos 110812 (F-)
WI1-2348N8				BX682541.5	100%	pos 38461 (F+)
WI1-2422E24				AL807778.10	99.83%	pos 38680 (F-)
WI1-2473G14	AL807778.10	100%	pos 195504 (R+)	BX682541.5	99.72%	pos 35366 (F-)
WI1-2499E13	AL807778.10	100%	pos 13813 (R+)	AL807778.10	99.85%	pos 50814 (F-)
WI1-2535L3	AL807778.10	100%	pos 34651 (R+)	AL807778.10	100%	pos 74359 (F-)
WI1-2590L15	AL807778.10	100%	pos 120276 (R+)	AL807778.10	99.61%	pos 159932 (F-)
WI1-2594B3				AL807778.10	100%	pos 79227 (F-)
WI1-2634G15	AL807778.10	100%	pos 116389 (R+)	AL807778.10	100%	pos 159351 (F-)
WI1-2637O8	BX682541.5	99.11%	pos 42875 (R-)	BX682541.5	99.56%	pos 775 (F+)
WI1-2689H17				AL807778.10	99.53%	pos 144989 (F+)
WI1-275G7	AL807778.10	100%	pos 62413 (R-)	AL807778.10	99.72%	pos 26093 (F+)
WI1-2833E12	AL807778.10	100%	pos 184297 (R-)	AL807778.10	100%	pos 145019 (F+)
WI1-2889O7	AL807778.10	100%	pos 90129 (R-)	AL807778.10	99.25%	pos 47308 (F+)
WI1-369C6				AL807778.10	99.82%	pos 22132 (F-)
WI1-428N18	AL807778.10	100%	pos 49941 (R-)	AL807778.10	99.65%	pos 18139 (F+)
WI1-442I19	AL807778.10	100%	pos 80801 (R-)	AL807778.10	100%	pos 46055 (F+)
WI1-450B2	BX682541.5	99.25%	pos 55387 (R+)
WI1-460I2	BX682541.5	99.49%	pos 2793 (R-)
WI1-557K1	AL807778.10	99.38%	pos 3311 (R+)	AL807778.10	100%	pos 44605 (F-)
WI1-55H17				AL807778.10	99.68%	pos 6102 (F-)
WI1-580C4				AL807778.10	100%	pos 34470 (F-)
WI1-590G13	AL807778.10	100%	pos 103588 (R-)	AL807778.10	99.84%	pos 63841 (F+)
WI1-744O9	AL807778.10	99.49%	pos 98835 (R+)	AL807778.10	99.67%	pos 142290 (F-)
WI1-829K11	AL807778.10	100%	pos 118149 (R+)	AL807778.10	99.74%	pos 156355 (F-)
WI1-919H24	AL807778.10	100%	pos 196616 (R-)	AL807778.10	100%	pos 159898 (F+)
WI1-920H9	AL807778.10	100%	pos 16624 (R+)	AL807778.10	100%	pos 59897 (F-)
WI1-957N3				AL807778.10	99.07%	pos 25978 (F+)

NCBI

Join Evaluation Legend

Curator Links

Alignment for AL807778.10 and BX682541.5

Alignment Summary

Alignment 1 of 1