ncbi logo		 UniSTS logo
 PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure
  Search for

Entrez UniSTS
Help
Query tips
Submit
Submit map
FTP site
Statistics

Related sites
e-PCR
Map Viewer
Gene
UniGene
dbSNP
GeneMap'99
MGD
ZFIN

Genomic biology
Bos taurus
Canis familiaris
Danio rerio
Homo sapiens
Mus musculus
Rattus novegicus
Sus scrofa

UniSTS:62677 Links
D15S1348
Homo sapiens chromosome 15, locus TYRO3
Mus musculus chromosome 2, loci Tyro3 and LOC100048488
Pan troglodytes chromosome 15, locus LOC453352
Rattus norvegicus chromosome 3, locus Tyro3

Found by e-PCR in sequences from Homo sapiens, Mus musculus, Pan troglodytes and Rattus norvegicus.

Primer InformationHelp

Forward primer:TAGTCCTCCCAAGCTGTGCT
Reverse primer:AGGGTAGGGCCCACAGAG
PCR product size:240 (bp), Homo sapiens
GenBank Accession:G13620 U18934

   Homo sapiens
Name: D15S1348
Also known as: GDB:737983 GDB:738818 SHGC-11895
Polymorphism info:  

Cross References Help
Gene GeneID:7301
 Symbol:TYRO3
 Description:TYRO3 protein tyrosine kinase
 Position:15q15.1-q21.1
UniGeneHs.381282 TYRO3 protein tyrosine kinase

Mapping InformationHelp
D15S1348 Sequence Map: Chr 15|Celera Map Viewer
  Position: 18638554-18638793 (bp)
 
D15S1348 Sequence Map: Chr 15|HuRef Map Viewer
  Position: 18718786-18719025 (bp)
 
D15S1348 Sequence Map: Chr 15 Map Viewer
  Position: 39657879-39658118 (bp)
 
SHGC-11895 NCBI RH Map: Chr 15 Map Viewer
  Position: 112.1 (cR)
  Lod score: 1.86
 
SHGC-11895 Stanford-G3 Map: Chr 15 Map Viewer
  Position: 1052 (cR10000)
  Lod score: F
  Reference Interval: 19
 
SHGC-11895 GeneMap99-G3 Map: Chr 15 Map Viewer
  Position: 1052 (cR10000)
  Lod score: F
  Reference Interval: D15S118-D15S146

Electronic PCR results Help
RefSeq mRNA (1)
NM_006293.2 3010 .. 3249 (240 bp)  
 
mRNA (8)
U05682.1 2792 .. 3031 (240 bp)  
U18934.1 3416 .. 3655 (240 bp)  
D17517.1 3010 .. 3249 (240 bp)  
BC034960.1 2804 .. 3043 (240 bp)  
BC049368.1 2796 .. 3035 (240 bp)  
BC051756.1 2801 .. 3040 (240 bp)  
BC029925.2 1672 .. 1911 (240 bp)  
AK131389.1 1055 .. 1294 (240 bp)  
 
Genomic (7)
G13620.1 113 .. 352 (240 bp)  
AC016134.7 74167 .. 74406 (240 bp)  
CH003510.1 19763369 .. 19763607 (239 bp)  
CH471125.1 8921323 .. 8921562 (240 bp)  
CM000266.1 18638554 .. 18638793 (240 bp)  
DS486083.1 1999987 .. 2000226 (240 bp)  
CM000476.1 18718786 .. 18719025 (240 bp)  
 
Working Draft phase 1 (from GenBank HTGS division) (1)
AL353642.4 42930 .. 43169 (240 bp)  
 
ESTs (14)
W48586.1 146 .. 391 (246 bp)  
BE731119.1 328 .. 567 (240 bp)  
BE875556.1 247 .. 486 (240 bp)  
BE908184.1 379 .. 620 (242 bp)  
BG475857.1 505 .. 747 (243 bp)  
BG819651.1 220 .. 459 (240 bp)  
BG820098.1 243 .. 488 (246 bp)  
BG911270.1 305 .. 545 (241 bp)  
BI254054.1 359 .. 601 (243 bp)  
CF456521.1 20 .. 259 (240 bp)  
AL521805.3 691 .. 929 (239 bp)  
AL521806.3 10 .. 249 (240 bp)  
BX394266.2 678 .. 916 (239 bp)  
CN420890.1 52 .. 292 (241 bp)  
 
Whole Genome Shotgun sequences (3)
AADC01120096.1 2168 .. 2406 (239 bp)  
AADB02016420.1 1518926 .. 1519165 (240 bp)  
ABBA01038400.1 2369 .. 2608 (240 bp)  
 

   Mus musculus
Name: D15S1348
Polymorphism info:  

Cross References Help
Gene GeneID:100048488
 Symbol:LOC100048488
 Description:similar to Rse
 Position: 
Gene GeneID:22174
 Symbol:Tyro3
 Description:TYRO3 protein tyrosine kinase 3
 Position:2 F|2 67.1 cM
UniGeneMm.2901 TYRO3 protein tyrosine kinase 3

Mapping InformationHelp
D15S1348 Sequence Map: Chr 2 Map Viewer
  Position: 119642879-119643115 (bp)
 
D15S1348 Sequence Map: Chr 2|Celera Map Viewer
  Position: 120972617-120972853 (bp)

Electronic PCR results Help
RefSeq mRNA (2)
NM_019392.2 3028 .. 3264 (237 bp)  
XM_001480339.1 2794 .. 3030 (237 bp)  
 
mRNA (5)
U18933.1 2964 .. 3200 (237 bp)  
U18342.1 2945 .. 3182 (238 bp)  
U18343.1 3488 .. 3725 (238 bp)  
D17393.1 3467 .. 3703 (237 bp)  
BC066058.1 3028 .. 3264 (237 bp)  
 
Genomic (3)
AL844896.7 34788 .. 35024 (237 bp)  
CH466519.1 80867911 .. 80868147 (237 bp)  
CM000210.1 117972617 .. 117972853 (237 bp)  
 
ESTs (5)
AI325374.1 73 .. 309 (237 bp)  
BI694765.1 15 .. 251 (237 bp)  
BI732673.1 139 .. 375 (237 bp)  
BQ931066.1 56 .. 292 (237 bp)  
CX200101.1 303 .. 543 (241 bp)  
 
Whole Genome Shotgun sequences (2)
CAAA01073105.1 4316 .. 4552 (237 bp)  
AAHY01020027.1 2093 .. 2329 (237 bp)  
 

   Pan troglodytes
Name: D15S1348
Polymorphism info:  

Cross References Help
Gene GeneID:453352
 Symbol:LOC453352
 Description:similar to TYRO3 protein tyrosine kinase
 Position: 

Mapping InformationHelp
D15S1348 Sequence Map: Chr 15 Map Viewer
  Position: 38598095-38598334 (bp)

Electronic PCR results Help
RefSeq mRNA (1)
XR_024071.1 2855 .. 3094 (240 bp)  
 
Genomic (1)
CM000329.1 38598095 .. 38598334 (240 bp)  
 
Whole Genome Shotgun sequences (2)
AADA01179000.1 19682 .. 19921 (240 bp)  
AACZ02154354.1 1666 .. 1905 (240 bp)  
 

   Rattus norvegicus
Name: D15S1348
Polymorphism info:  

Cross References Help
Gene GeneID:25232
 Symbol:Tyro3
 Description:TYRO3 protein tyrosine kinase
 Position:3q36.1
UniGeneRn.8883 TYRO3 protein tyrosine kinase 3

Mapping InformationHelp
D15S1348 Sequence Map: Chr 3|Celera Map Viewer
  Position: 105706811-105707047 (bp)
 
D15S1348 Sequence Map: Chr 3 Map Viewer
  Position: 106327658-106327894 (bp)

Electronic PCR results Help
RefSeq mRNA (1)
NM_017092.1 2778 .. 3014 (237 bp)  
 
mRNA (1)
D37880.1 2778 .. 3014 (237 bp)  
 
Genomic (4)
CM000074.1 106327658 .. 106327894 (237 bp)  
CH473949.1 62470687 .. 62470923 (237 bp)  
CM000233.2 105706811 .. 105707047 (237 bp)  
DH714341.1 54 .. 290 (237 bp)  
 
Working Draft phase 2 (from GenBank HTGS division) (1)
AC107565.5 198949 .. 199185 (237 bp)  
 
ESTs (1)
CO575534.1 184 .. 420 (237 bp)  
 
Whole Genome Shotgun sequences (2)
AABR03026504.1 10689 .. 10925 (237 bp)  
AAHX01024631.1 16872 .. 17108 (237 bp)  
 

 

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement