refSNP ID: rs11549887 Organism: human (Homo sapiens) Molecule Type: cDNA Created/Updated in build: 120/129 Map to Genome Build: 36.3 Allele Variation Class: SNP: single nucleotide polymorphism RefSNP Alleles: C/T Ancestral Allele: Not available Clinical Association: unknown HGVS Names NM_002819.3:c.1014C>T NM_031990.2:c.993C>T NM_031991.2:c.936C>T NM_175847.1:c.40-1418C>T NP_002810.1:p.A338A NP_114367.1:p.A331A NP_114368.1:p.A312A NT_011255.14:g.746450C>T NT_011255.14:g.746451C>T Links SNP Details are organized in the following sections: Submission Fasta Resource GeneView Map Diversity Validation   Submitter records for this RefSNP Cluster The submission ss16249878 has the longest flanking sequence of all cluster members and was used to instantiate sequence for rs11549887 during BLAST analysis for the current build. NCBI Assay ID Handle|Submitter ID Validation Status ss to rs Orientation /Strand Alleles 5' Near Seq 30 bp 3' Near Seq 30 bp Entry Date Update Date Build Added Molecule Type Freq Warning Ancestral Allele Success Rate ss16249878 CGAP-GAI|1498818 fwd/B C/T gaacgtccacggcgccctggcccccctggc atcccctcggcggcggcggcagctgcggcg 11/18/03 11/22/03 120 cDNA unknown   Fasta sequence   (Legend) >gnl|dbSNP|rs11549887|allelePos=51|totalLen=101|taxid=9606|snpclass=1|alleles='C/T'|mol=cDNA|build=120 GCTGCAGGCC TTTCCGTTCC GAACGTCCAC GGCGCCCTGG CCCCCCTGGC Y ATCCCCTCGG CGGCGGCGGC AGCTGCGGCG GCAGGTCGGA TCGCCATCCC   GeneView GeneView via analysis of contig annotation: PTBP1 polypyrimidine tract binding protein 1 View variations for gene: Include clinically associated: in gene region cSNP has frequency double hit Group Label Contig->mRNA Gene Model (contig mRNA transcript) Color Legend reference NT_011255->NM_002819 function reference NT_011255->NM_031990 function reference NT_011255->NM_031991 function reference NT_011255->NM_175847 function " Group label Contig-->mRNA-->Protein Contig position mRNA orientation mRNA pos Function dbSNP allele Protein residue Codon pos Amino acid pos reference NT_011255->NM_002819->NP_002810 746451 forward 1101 synonymous T Ala [A] 3 338 contig reference C Ala [A] 3 338 reference NT_011255->NM_031990->NP_114367 746451 forward 1080 synonymous T Ala [A] 3 331 contig reference C Ala [A] 3 331 reference NT_011255->NM_031991->NP_114368 746451 forward 1023 synonymous T Ala [A] 3 312 contig reference C Ala [A] 3 312 reference NT_011255->NM_175847->NP_787041 746451 forward intron GeneView: no link established by BLAST analysis of mRNA sequences   Integrated Maps: NCBI MapViewer:  rs11549887 maps exactly once on NCBI human chromosome 19 Chromosome Contig accession Contig position Chromosome position Hit orientation Contig Allele Assembly Type Group label Contig label Neighbor SNP SNP_flank position 19 NW_927140.1 9758 9758 minus G alt_assembly_1 Celera Celera view 50 19 NW_001838476.1 564795 575596 plus C alt_assembly_8 HuRef HuRef view 50 19 NT_011255.14 746451 757451 plus C ref_assembly reference reference view 50   NCBI Resource Links Submitter-Referenced GenBank BI771293 BE281447 dbSNP Blast Analysis NCBI RefSeq NM (mRNA): GenBank mRNA: NM_002819.3 NM_031990.2 NM_031991.2 AB208910.1 BC002397.2 BC004383.1 BC013694.1 BT006819.1 X60648.1 X62006.1 X65371.1 X65372.1 X66975.1 UniGene Cluster ID 172550   Population Diversity There is no frequency data.   Validation Summary: Validation status Marker displays Mendelian segregation PCR results confirmed in multiple reactions Homozygotes detected in individual genotype data UNKNOWN UNKNOWN UNKNOWN

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION: FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .