PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:23489 Links D10S2291 Homo sapiens chromosome 10, locus KCNMA1 Pan troglodytes chromosome 10, locus LOC466115 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: CAATCCCAGTACCCCCATC Reverse primer: GGGATTTAACAAATGTCTGAAAGG PCR product size: 349-350 (bp), Homo sapiens GenBank Accession: G06537 U02632    Homo sapiens Name: D10S2291 Also known as: G00-679-146 GDB:679146 SHGC-12583 UTR-04933 WI-7359 Polymorphism info:   Cross References Gene GeneID: 3778   Symbol: KCNMA1   Description: potassium large conductance calcium-activated channel, subfamily M, alpha member 1   Position: 10q22.3 UniGene Hs.144795 Potassium large conductance calcium-activated channel, subfamily M, alpha me... Mapping Information D10S2291 Sequence Map: Chr 10|Celera Map Viewer   Position: 71928741-71929090 (bp)   D10S2291 Sequence Map: Chr 10|HuRef Map Viewer   Position: 72638853-72639202 (bp)   D10S2291 Sequence Map: Chr 10 Map Viewer   Position: 78313927-78314276 (bp)   SHGC-12583 GeneMap99-G3 Map: Chr 10 Map Viewer   Position: 3555 (cR10000)   Lod score: 0.32   Reference Interval: D10S195-D10S1786   WI-7359 Whitehead-YAC Map: Chr 10 Map Viewer   Reference Interval: WC10.5 Electronic PCR results mRNA (1) U02632.1 2694 .. 3043 (350 bp)     Genomic (5 of 8)[Show All Hits] G06537.1 34 .. 383 (350 bp)   AC011439.12 83747 .. 84096 (350 bp)   CH003457.1 71925280 .. 71925629 (350 bp)   CH003505.1 75567295 .. 75567644 (350 bp)   CH471083.1 26122984 .. 26123333 (350 bp)     Whole Genome Shotgun sequences (4) AADD01108951.1 20144 .. 20493 (350 bp)   AADC01092269.1 12001 .. 12350 (350 bp)   AADB02013194.1 56614 .. 56963 (350 bp)   ABBA01020239.1 27176 .. 27525 (350 bp)        Pan troglodytes Name: D10S2291 Polymorphism info:   Cross References Gene GeneID: 466115   Symbol: LOC466115   Description: similar to large conductance calcium-activated potassium channel subfamily M alpha member 1 isoform a   Position:   Mapping Information D10S2291 Sequence Map: Chr 10 Map Viewer   Position: 76140093-76140442 (bp) Electronic PCR results Genomic (1) CM000324.1 76140093 .. 76140442 (350 bp)     Whole Genome Shotgun sequences (2) AADA01075042.1 12787 .. 13136 (350 bp)   AACZ02115325.1 7897 .. 8246 (350 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement