PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:22934 Links WI-11443 Bos taurus chromosome 18, loci LOC785843, CWC15, and LOC505697 Homo sapiens chromosome 11, locus CWC15 Pan troglodytes locus CWC15 Found by e-PCR in sequences from Bos taurus, Homo sapiens, Ovis aries and Pan troglodytes. Primer Information Forward primer: CAAGAAGAGCTGCAGTATCATCA Reverse primer: CAGAACATACAACCTCCTCTTCA PCR product size: 150 (bp), Homo sapiens GenBank Accession: G21474 T89356    Bos taurus Name: WI-11443 Polymorphism info:   Cross References Gene GeneID: 505697   Symbol: LOC505697   Description: similar to Ryanodine receptor 1 (Skeletal muscle-type ryanodine receptor) (RyR1) (RYR-1) (Skeletal muscle calcium release channel)   Position:   Gene GeneID: 535258   Symbol: CWC15   Description: CWC15 spliceosome-associated protein homolog (S. cerevisiae)   Position:   Gene GeneID: 785843   Symbol: LOC785843   Description: similar to CWC15 homolog   Position:   UniGene Bt.1333 Hypothetical protein LOC785843   Bt.1540 Similar to RIKEN cDNA 0610040D20 Mapping Information WI-11443 Sequence Map: Chr 18 Map Viewer   Position: 48019833-48019988 (bp) Electronic PCR results RefSeq mRNA (2) NM_001046399.1 398 .. 553 (156 bp)   XR_028185.1 322 .. 477 (156 bp)     mRNA (1) BC105398.1 398 .. 553 (156 bp)     Genomic (2) CM000194.3 48019833 .. 48019988 (156 bp)   CM000191.3 13681505 .. 13683068 (1564 bp)     Working Draft phase 1 (from GenBank HTGS division) (3) AC159559.2 31586 .. 31741 (156 bp)   AC160784.2 22121 .. 22276 (156 bp)   AC164058.3 33660 .. 35223 (1564 bp)     ESTs (5 of 93)[Show All Hits] CB222677.1 305 .. 460 (156 bp)   CB437556.1 305 .. 460 (156 bp)   CF614934.1 311 .. 466 (156 bp)   CF763281.1 385 .. 540 (156 bp)   CF765974.1 381 .. 536 (156 bp)     Whole Genome Shotgun sequences (2) AAFC03095769.1 10331 .. 10486 (156 bp)   AAFC03007157.1 33660 .. 35223 (1564 bp)        Equus caballus   Polymorphism info:   Cross References UniGene Eca.8699 Hypothetical protein LOC100061007    Homo sapiens Name: WI-11443 Also known as: EST159477 Polymorphism info:   Cross References Gene GeneID: 51503   Symbol: CWC15   Description: CWC15 spliceosome-associated protein homolog (S. cerevisiae)   Position: 11q21 UniGene Hs.503597 CWC15 homolog (S. cerevisiae) Mapping Information View all results using the Map Viewer   WI-11443 NCBI RH Map: Chr 11 Map Viewer   Position: 794.1 (cR)   Lod score: 1.11   WI-11443 Whitehead-RH Map: Chr 11 Map Viewer   Position: 416.2 (cR3000)   Lod score: P0.02   WI-11443 GeneMap99-GB4 Map: Chr 11 Map Viewer   Position: 319.17 (cR3000)   Lod score: 3.00   Reference Interval: D11S1311-D11S917 Electronic PCR results RefSeq mRNA (1) NM_016403.3 365 .. 514 (150 bp)     mRNA (4) AF110775.1 305 .. 454 (150 bp)   AJ250393.1 322 .. 471 (150 bp)   BC040946.1 317 .. 466 (150 bp)   AK225956.1 324 .. 473 (150 bp)     Genomic (5 of 8)[Show All Hits] G21474.1 1 .. 150 (150 bp)   AP002383.3 93010 .. 94039 (1030 bp)   CH003506.1 95097929 .. 95098958 (1030 bp)   DQ046616.1 242 .. 391 (150 bp)   CH471065.1 4859890 .. 4860919 (1030 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC032024.3 50821 .. 51850 (1030 bp)   AC023756.3 14466 .. 15496 (1031 bp)     ESTs (5 of 186)[Show All Hits] T89356.1 1 .. 150 (150 bp)   W07735.1 290 .. 444 (155 bp)   W39225.1 272 .. 424 (153 bp)   W72164.1 290 .. 439 (150 bp)   W73840.1 297 .. 446 (150 bp)     Whole Genome Shotgun sequences (3) AADC01101210.1 288528 .. 289557 (1030 bp)   AADB02014322.1 1020422 .. 1021451 (1030 bp)   ABBA01040022.1 45960 .. 46989 (1030 bp)        Macaca mulatta   Polymorphism info:   Cross References UniGene Mmu.4254 Similar to RIKEN cDNA 0610040D20    Ovis aries   Polymorphism info:   Cross References UniGene Oar.9380 Transcribed locus, strongly similar to NP_057487.1 hypothetical protein LOC5... Electronic PCR results ESTs (5 of 17)[Show All Hits] DY512049.1 322 .. 477 (156 bp)   EE749122.1 432 .. 587 (156 bp)   EE750510.1 241 .. 396 (156 bp)   EE770438.1 303 .. 459 (157 bp)   EE775530.1 309 .. 464 (156 bp)        Pan troglodytes   Polymorphism info:   Cross References Gene GeneID: 451493   Symbol: CWC15   Description: CWC15 spliceosome-associated protein homolog (S. cerevisiae)   Position:   Electronic PCR results RefSeq mRNA (3) XM_001144067.1 520 .. 669 (150 bp)   XM_508705.2 337 .. 486 (150 bp)   XM_001144223.1 365 .. 514 (150 bp)     Genomic (1) CM000325.1 93500973 .. 93502007 (1035 bp)     Whole Genome Shotgun sequences (2) AADA01074871.1 11225 .. 12259 (1035 bp)   AACZ02127356.1 11395 .. 12429 (1035 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement