Origin IGS:
taaatttcatgatgcaaatatccggataggtctgttcttcaaatgtcacttatgtgacagagctgtttttttattgttttttgtgagagaaatgcccatacgtcttgcgcagacgttcgtcaagtatccgaaagtcttcgcgagcttcacaaatctcttcaacggcgatcgaacatctccgcgcaccccacgcgatattcgttttttgccccgacatgtttggttta
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9.........1.........2.........3.........4.........5.........6.........7.........8.........9
taaaccaaacatgtcggggcaaaaaacgaatatcgcgtggggtgcgcggagatgttcgatcgccgttgaagagatttgtgaagctcgcgaagactttcggatacttgacgaacgtctgcgcaagacgtatgggcatttctctcacaaaaaacaataaaaaaacagctctgtcacataagtgacatttgaagaacagacctatccggatatttgcatcatgaaattta

Mask Tandem Repeat Region ================================================
taaatttcatgatgcaaatatccggataggtctgttcttcaaatgtcacttatgtgacagagctgtttttttattgttttttgtgagagaaatgcccatacgtcttgcgcagacgttcgtcaagtatccgaaagtcttcgcgagcttcacaaatctcttcaacggcgatcgaacatctccgcgcaccccacgcgatattcgttttttgccccgacatgtttggttta

Find is-nt database================================================
Query_seq: TF2790:TF2791|TF2790:TF2791:prismane protein, hybrid-cluster protein:GTP-binding protein TypA:->->:2975211..2975437 227
taaatttcatgatgcaaatatccggataggtctgttcttcaaatgtcacttatgtgacagagctgtttttttattgttttttgtgagagaaatgcccatacgtcttgcgcagacgttcgtcaagtatccgaaagtcttcgcgagcttcacaaatctcttcaacggcgatcgaacatctccgcgcaccccacgcgatattcgttttttgccccgacatgtttggttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find is-aa database================================================
Query_seq: TF2790:TF2791|TF2790:TF2791:prismane protein, hybrid-cluster protein:GTP-binding protein TypA:->->:2975211..2975437 227
taaatttcatgatgcaaatatccggataggtctgttcttcaaatgtcacttatgtgacagagctgtttttttattgttttttgtgagagaaatgcccatacgtcttgcgcagacgttcgtcaagtatccgaaagtcttcgcgagcttcacaaatctcttcaacggcgatcgaacatctccgcgcaccccacgcgatattcgttttttgccccgacatgtttggttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

Find nr database================================================
Query_seq: TF2790:TF2791|TF2790:TF2791:prismane protein, hybrid-cluster protein:GTP-binding protein TypA:->->:2975211..2975437 227
taaatttcatgatgcaaatatccggataggtctgttcttcaaatgtcacttatgtgacagagctgtttttttattgttttttgtgagagaaatgcccatacgtcttgcgcagacgttcgtcaagtatccgaaagtcttcgcgagcttcacaaatctcttcaacggcgatcgaacatctccgcgcaccccacgcgatattcgttttttgccccgacatgtttggttta
Intra-Species Hit: Count: 0
Inter-species Hit: Count: 0

taaatttcatgatgcaaatatccggataggtctgttcttcaaatgtcacttatgtgacagagctgtttttttattgttttttgtgagagaaatgcccatacgtcttgcgcagacgttcgtcaagtatccgaaagtcttcgcgagcttcacaaatctcttcaacggcgatcgaacatctccgcgcaccccacgcgatattcgttttttgccccgacatgtttggttta
Predict ORF larger than 30AA ================================================
Protein_Len: 51	Strand: +	Start: 73	End: 225
........................................................................ M  V  F  C  E  R  N  A  H  T  S  C  A  D  V  R  Q  V  S  E  S  L  R  E  L  H  K  S  L  Q  R  R  S  N  I  S  A  H  P  T  R  Y  S  F  F  A  P  T  C  L  V ..
Protein_Len: 60	Strand: +	Start: 20	End: 226
................... M  R  I  G  L  F  F  K  C  H  L  C  D  R  A  V  F  L  L  F  F  V  R  E  M  P  I  R  L  A  Q  T  F  V  K  Y  P  K  V  F  A  S  F  T  N  L  F  N  G  D  R  T  S  P  R  T  P  R  D  I .
Protein_Len: 41	Strand: +	Start: 105	End: 227
........................................................................................................ M  R  R  R  S  S  S  I  R  K  S  S  R  A  S  Q  I  S  S  T  A  I  E  H  L  R  A  P  H  A  I  F  V  F  C  P  D  M  F  G  L 
Protein_Len: 48	Strand: -	Start: 74	End: 217
......................................................................... Q  K  K  H  S  F  H  G  Y  T  K  R  L  R  E  D  L  I  R  F  D  E  R  A  E  C  I  E  E  V  A  I  S  C  R  R  A  G  W  A  I  N  T  K  Q  G  S  M ..........
Protein_Len: 50	Strand: -	Start: 49	End: 198
................................................ K  H  S  L  A  T  K  K  N  N  K  T  L  S  I  G  M  R  R  A  C  V  N  T  L  Y  G  F  T  K  A  L  K  V  F  R  K  L  P  S  R  V  D  G  R  V  G  R  S  M .............................

taaatttcatgatgcaaatatccggataggtctgttcttcaaatgtcacttatgtgacagagctgtttttttattgttttttgtgagagaaatgcccatacgtcttgcgcagacgttcgtcaagtatccgaaagtcttcgcgagcttcacaaatctcttcaacggcgatcgaacatctccgcgcaccccacgcgatattcgttttttgccccgacatgtttggttta
Predict Promoter with matrix: RpoD-15 score > 80================================================

Predict Promoter with matrix: RpoD-16 score > 80================================================

Predict Promoter with matrix: RpoD-17 score > 80================================================

Predict Promoter with matrix: RpoD-18 score > 80================================================

Predict Promoter with matrix: RpoD-19 score > 80================================================

Predict Promoter with matrix: RpoN score > 80================================================

taaatttcatgatgcaaatatccggataggtctgttcttcaaatgtcacttatgtgacagagctgtttttttattgttttttgtgagagaaatgcccatacgtcttgcgcagacgttcgtcaagtatccgaaagtcttcgcgagcttcacaaatctcttcaacggcgatcgaacatctccgcgcaccccacgcgatattcgttttttgccccgacatgtttggttta
Predict TransTerm conf > 70================================================

Find igs database================================================
Query_seq: TF2790:TF2791|TF2790:TF2791:prismane protein, hybrid-cluster protein:GTP-binding protein TypA:->->:2975211..2975437 227
taaatttcatgatgcaaatatccggataggtctgttcttcaaatgtcacttatgtgacagagctgtttttttattgttttttgtgagagaaatgcccatacgtcttgcgcagacgttcgtcaagtatccgaaagtcttcgcgagcttcacaaatctcttcaacggcgatcgaacatctccgcgcaccccacgcgatattcgttttttgccccgacatgtttggttta
Intra-Species Hit: Count: 1	Min: 1	Max: 227	Len: 227
Subject: tfor_TF2790_TF2791|prismane protein, hybrid-cluster protein:GTP-binding protein TypA|POSITIVE:POSITIVE|[2975211,2975437]|227
HSP  1	e-value: 8.0E-77	bit: 287.0	Len: 145	Query Start:83	Query End:227	Subject Strand: POSITIVE	Subject Start: 83	Subject End: 227
..................................................................................gtgagagaaatgcccatacgtcttgcgcagacgttcgtcaagtatccgaaagtcttcgcgagcttcacaaatctcttcaacggcgatcgaacatctccgcgcaccccacgcgatattcgttttttgccccgacatgtttggttta
..................................................................................gtgagagaaatgcccatacgtcttgcgcagacgttcgtcaagtatccgaaagtcttcgcgagcttcacaaatctcttcaacggcgatcgaacatctccgcgcaccccacgcgatattcgttttttgccccgacatgtttggttta
HSP  2	e-value: 4.0E-29	bit: 129.0	Len: 65	Query Start:1	Query End:65	Subject Strand: POSITIVE	Subject Start: 1	Subject End: 65
taaatttcatgatgcaaatatccggataggtctgttcttcaaatgtcacttatgtgacagagctg..................................................................................................................................................................
taaatttcatgatgcaaatatccggataggtctgttcttcaaatgtcacttatgtgacagagctg..................................................................................................................................................................

Inter-species Hit: Count: 0

Predict Forward Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAAUUUCAUGAUGCAAAUAUCCGGAUAGGUCUGUUCUUCAAAUGUCACUUAUGUGACAGAGCUGUUUUUUUAUUGUUUUUUGUGAGAGAAAUGCCCAUACGUCUUGCGCAGACGUUCGUCAAGUAUCCGAAAGUCUUCGCGAGCUUCACAAAUCUCUUCAACGGCGAUCGAACAUCUCCGCGCACCCCACGCGAUAUUCGUUUUUUGCCCCGACAUGUUUGGUUUA
((((((.((((..(((((.(..((((((....(((((......((((((....))))))..((((((........(...((((((((....(((......)))((((((.((((.((((.........)))).)))).)))))).)))))))).).....))))))....)))))....((((.......)))).))))))..)))))).....))))...)))))) (-56.12)

Predict Reverse Strand Minimun Free Energy by RNAFold (ViennaRNA) ================================================
UAAACCAAACAUGUCGGGGCAAAAAACGAAUAUCGCGUGGGGUGCGCGGAGAUGUUCGAUCGCCGUUGAAGAGAUUUGUGAAGCUCGCGAAGACUUUCGGAUACUUGACGAACGUCUGCGCAAGACGUAUGGGCAUUUCUCUCACAAAAAACAAUAAAAAAACAGCUCUGUCACAUAAGUGACAUUUGAAGAACAGACCUAUCCGGAUAUUUGCAUCAUGAAAUUUA
.........((((.....(((((...((((((((.((((.....))))..))))))))....(((.(((.((((..(((..(.((.(((.((((.((((.........)))).)))).))).)).....)..)))..)))))))........................((((((....))))))...................)))...)))))..))))....... (-56.30)

Find mRNA Target Using  Conserved IGS================================================
5'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
435	215	179	217	169	tfor:TF2561|5end_50S_ribosomal_protein_L16_2738693..2738923_POSITIVE
402	200	153	56	5	tfor:TF1548|5end_thiophene_and_furan_oxidation_protein_1652501..1652731_POSITIVE
394	150	101	229	170	tfor:TF0809|5end_cation_efflux_protein_865358..865588_POSITIVE
382	144	101	151	107	tfor:TF0280|5end_hypothetical_protein_308807..309037_POSITIVE
371	130	81	173	125	tfor:TF0729|5end_DNA_primase_780107..780337_POSITIVE
368	208	163	159	111	tfor:TF0215|5end_tRNA/rRNA_methyltransferase,_TrmH_family_241463..241693_POSITIVE
365	148	101	97	45	tfor:TF2853|5end_2-C-methyl-D-erythritol_2,4-cyclodiphosphate_synthase_3040172..3040402_POSITIVE
359	203	162	206	147	tfor:TF2166|5end_hypothetical_protein_2342115..2342345_POSITIVE
356	148	101	195	144	tfor:TF2786|5end_hypothetical_protein_2969851..2970081_POSITIVE
353	217	173	60	3	tfor:TF2358|5end_possible_small-conductance_mechanosensitive_channel_2523829..2524059_POSITIVE
350	148	101	69	32	tfor:TF2310|5end_dehydrogenase,_possible_3-oxoacyl-[acyl-carrier-protein]_reductase_2470481..2470711_POSITIVE
349	210	164	111	53	tfor:TF2914|5end_hypothetical_protein_3109345..3109575_POSITIVE
349	140	101	184	142	tfor:TF0953|5end_conserved_hypothetical_protein;_possible_DNA_binding_protein_997929..998159_POSITIVE
345	148	101	172	121	tfor:TF2226|5end_CTn_excision_protein_2395529..2395759_POSITIVE
344	195	154	57	11	tfor:TF0944|5end_TonB-dependent_receptor_986340..986570_POSITIVE
343	150	101	144	93	tfor:TF2517|5end_hypothetical_protein_2695089..2695319_POSITIVE
340	214	175	102	54	tfor:TF2793|5end_possible_L-lysine_2,3-aminomutase_2977661..2977891_POSITIVE
337	139	95	62	4	tfor:TF2385|5end_conserved_hypothetical_protein;_possible_MazG_family_protein_2550676..2550906_POSITIVE
335	160	113	69	8	tfor:TF3064|5end_oxidoreductase,_aldo/keto_reductase_family_3289765..3289995_POSITIVE
335	197	163	50	10	tfor:TF0038|5end_conserved_hypothetical_protein_39907..40137_POSITIVE

3'END mRNA Target Prediction===================================
Score	srna_start	srna_end	target_start	tegart_end	seq_id
365	148	101	66	14	tfor:TF2852|3end_conserved_hypothetical_protein_3040221..3040371_POSITIVE
347	136	93	133	92	tfor:TF1846|3end_hypothetical_protein_1997015..1997165_POSITIVE
347	136	93	123	82	tfor:TF1845|3end_hypothetical_protein_1997005..1997155_POSITIVE
338	189	141	135	82	tfor:TF1168|3end_hypothetical_protein_1249092..1249242_POSITIVE
337	139	95	62	4	tfor:TF2384|3end_thiol:disulfide_interchange_protein_2550756..2550906_POSITIVE
335	197	163	54	14	tfor:TF0037|3end_sialic_acid-specific_9-O-acetylesterase_39991..40141_POSITIVE
329	208	166	68	15	tfor:TF0705|3end_hypothetical_protein_750789..750939_POSITIVE
326	220	172	110	72	tfor:TF2547|3end_hypothetical_protein_2730947..2731097_POSITIVE
325	140	93	148	92	tfor:TF3105|3end_hypothetical_protein_3338342..3338492_POSITIVE
325	130	92	80	40	tfor:TF0603|3end_glycosyltransferase_634838..634988_POSITIVE
324	209	163	78	10	tfor:TF0599|3end_hypothetical_protein_630130..630280_POSITIVE
322	209	166	74	31	tfor:TF2159|3end_conserved_hypothetical_protein_2336076..2336226_POSITIVE
319	150	101	141	101	tfor:TF2831|3end_ABC_transporter,_permease_component_3022671..3022821_POSITIVE
318	110	63	151	94	tfor:TF1638|3end_conserved_hypothetical_protein_1747732..1747882_POSITIVE
316	189	141	57	4	tfor:TF1588|3end_hypothetical_protein_1702560..1702710_POSITIVE
316	210	162	60	7	tfor:TF0745|3end_conserved_hypothetical_protein_791074..791224_POSITIVE
315	189	141	50	8	tfor:TF2978|3end_conserved_hypothetical_protein_3190862..3191012_POSITIVE
314	147	102	113	71	tfor:TF3006|3end_response_regulator,_transcriptional_regulator_RprY_3227162..3227312_POSITIVE
314	210	164	135	80	tfor:TF1443|3end_hypothetical_protein_1528203..1528353_POSITIVE
314	143	102	151	98	tfor:TF0271|3end_oxidase/dehydrogenase_298530..298680_POSITIVE