NCBI

NLM

PubMed Nucleotide Protein Genome Structure PopSet Taxonomy OMIM Books SNP
Search for SNP on NCBI Reference Assembly
Spacer gif
BUILD 129
Have a question about dbSNP? Try searching the SNP FAQ Archive!

Spacer gif
SNP linked to Gene GPC1(geneID:2817) Via Contig Annotation
rs# on all gene models to Batch Query
all rs# to file.

  Gene Model (mRNA alignment) information from genome sequence back to top
Total gene model (contig mRNA transcript): 2
mrnatranscriptproteinmrna orientationContigContig LabelList SNP
NM_002081.2plus strandNP_002072.2forwardNT_005416.12reference<- currently shown
NM_002081.2plus strandNP_002072.2forwardNW_001838873.1HuRefView snp on GeneModel

Include clinically associated in gene region cSNP has frequency double hit

gene model
(contig mRNA transcript):
Contig LabelContigmrnaproteinmrna orientationtranscriptsnp count
referenceNT_005416.12NM_002081.2NP_002072.2forwardplus strand190, all

Color Legend

Region Contig
position
mRNA
pos
dbSNP rs#
cluster id
Hetero-
zygosity
Validation 3D Clinically
Associated
Function dbSNP
allele
Protein
residue
Codon
pos
Amino acid
pos
PubMed
5' near gene547725 rs4344933 0.380byClusterbyFreqwith2hitwithHapMapFreq 5' near geneA/G
547830 rs10182511 N.D. 5' near geneG/T
548135 rs6716265 0.496byClusterbyFreqwith2hitwithHapMapFreq 5' near geneC/T
548384 rs9973786 N.D.with2hit 5' near geneA/G
549032 rs62187173 N.D. 5' near geneC/T
549616 rs3828333 N.D. 5' near geneA/G
exon_1549940222start codon1
intron_1550131 rs2352823 N.D.byClusterwith2hit intronC/T
550318 rs13026814 N.D. intronA/C
550328 rs13026820 N.D. intronA/C
550553 rs60819115 N.D. intronC/T
551224 rs12467792 N.D. intronA/G
551328 rs35515676 N.D. intron-/T
552264 rs4553824 N.D.byClusterwith2hit intronC/T
552354 rs4311058 N.D.byClusterwith2hit intronA/G
553103 rs60805200 N.D. intronC/T
553213 rs58192469 N.D. intronA/C
553263 rs10184291 N.D.byClusterwith2hit intronA/G
553514 rs61056707 N.D. intronA/G
553695 rs56192488 N.D. intronG/T
553748 rs4558582 N.D.byClusterwith2hit intronC/T
553910 rs7570292 N.D. intronA/G
555271 rs61323318 N.D. intronA/G
555412 rs34962319 N.D. intron-/G
555754 rs34868838 N.D. intron-/C
555959 rs35333679 N.D. intron-/G
556043 rs10194112 N.D.byClusterwith2hit intronA/G
556099 rs59746067 N.D. intronC/T
556152 rs10211061 N.D.byClusterwith2hit intronC/T
556194 rs10211085 N.D.byClusterwith2hit intronC/T
556253 rs6718152 N.D. intronA/C
556345 rs6718278 N.D.with2hit intronC/T
556480 rs6706807 N.D. intronA/G
556687 rs7577243 0.493byClusterbyFreqwith2hitwithHapMapFreq intronA/G
556925 rs7572255 N.D.byClusterwith2hit intronC/T
556939 rs7577592 N.D.byClusterwith2hit intronA/G
556948 rs7572266 N.D.with2hit intronC/T
556950 rs7580870 N.D.byClusterwith2hit intronC/T
557224 rs6722129 N.D.byClusterwith2hit intronC/G
557314 rs36106834 N.D. intron-/T
557556 rs34880100 N.D. intron-/C
557885 rs7575970 N.D. intronC/T
558051 rs34771298 N.D. intron-/C
558150 rs10167614 N.D.byCluster intronA/G
558237 rs10933602 N.D.byClusterwith2hit intronA/G
558338 rs10933603 0.488byClusterbyFreqwith2hitwithHapMapFreq intronC/T
558571 rs10933604 0.488byClusterbyFreqwith2hitwithHapMapFreq intronA/G
558614 rs11676749 N.D. intronC/T
558682 rs28513094 N.D. intronC/G
559131 rs7569539 N.D.with2hit intronA/G
559917 rs11674983 N.D.byCluster intronC/T
560073 rs60270798 N.D. intronC/T
560080 rs4676438 N.D.byClusterwith2hit intronC/G
560173 rs58375515 N.D. intronC/G
560188 rs11685653 N.D.byClusterwith2hit intronG/T
560218 rs13419708 N.D.with2hit intronC/G
560219 rs13409716 N.D.with2hit intronA/G
560285 rs11692341 N.D.byClusterwith2hit intronA/G
560324 rs62187174 N.D. intronA/G
560391 rs13424854 0.290byFreqwith2hitwithHapMapFreq intronA/G
560427 rs7589322 0.408byClusterbyFreqwith2hitwithHapMapFreq intronA/G
560493 rs35667044 N.D. intronC/G
560866 rs7576734 N.D.byClusterwith2hit intronA/G
560922 rs34923214 N.D. intron-/G
560934 rs10207602 N.D.byClusterwith2hit intronC/T
560956 rs7576849 0.042byClusterbyFreqwith2hitwithHapMapFreq intronA/G
561009 rs55928262 N.D. intronC/T
561014 rs11902723 0.391byFreqwith2hitwithHapMapFreq intronA/G
561255 rs34880236 N.D. intron-/C
561376 rs35140969 N.D. intronA/G
561476 rs11687369 N.D.byCluster intronA/G
561483 rs11691816 N.D.byClusterwith2hit intronC/T
561552 rs62187175 N.D. intronA/G
561640 rs55963077 N.D. intronG/T
561943 rs13034612 N.D.with2hit intronG/T
562049 rs34174647 N.D. intronA/G
562084 rs35066644 N.D. intronC/G
562233 rs35638217 N.D. intronC/T
562286 rs35513738 N.D. intron-/G
562459 rs12990815 N.D. intronC/T
562473 rs13034395 N.D. intronA/C
562641 rs60196431 N.D. intron-/AGGTCG
562763 rs7599776 N.D.byClusterwith2hit intronA/G
562765 rs11693618 N.D.byCluster intronC/T
562771 rs4676357 N.D.byCluster intronA/C
562814 rs7594508 N.D. intronC/T
562876 rs6734609 N.D.with2hit intronA/G
563004 rs60345704 N.D. intronA/G
563150 rs35479259 N.D. intronC/T
563334 rs11376903 N.D. intron-/C
563404 rs58727534 N.D. intronC/T
563418 rs34548888 N.D. intronA/G
563461 rs4676356 N.D.byCluster intronG/T
563585 rs2844 0.500byClusterbyFreqwith2hit intronA/T
563765 rs1133953 N.D. intronA/G
563769 rs1133952 N.D. intronA/G
563823 rs13421123 N.D. intronA/G
564257 rs56781214 N.D. intronA/G
564410 rs60050368 N.D. intronC/T
564606 rs3828334 0.451byClusterbyFreqwith2hitwithHapMapFreq intronA/G
564631 rs3749127 0.051byFreq intronC/G
565120 rs3828336 0.325byClusterbyFreqwithHapMapFreq intronA/G
565431 rs34412658 N.D. intronC/T
565629 rs1320130 0.467byClusterbyFreqbySubmitterwith2hitwithHapMapFreq intronC/G
566584 rs28638300 N.D. intronG/T
566629 rs13431676 N.D. intronA/G
566681 rs35392247 N.D. intronA/G
567095 rs4268920 N.D. intronC/T
567172 rs4423588 N.D. intronA/G
567643 rs56137336 N.D. intronC/T
567786 rs55927876 N.D. intronC/T
567885 rs13010969 N.D. intronC/T
568291 rs35406163 N.D. intronC/G
568366 rs11892190 N.D.byCluster intronA/G
568526 rs12997581 N.D. intronA/G
569679 rs35867125 N.D. intron-/C
569957 rs12695019 N.D.byCluster intronA/G
570107 rs2292832 0.492byClusterbyFreqwith2hitwithHapMapFreq intronC/T
570239 rs3830535 N.D. intron-/GCGCCGAGG
570360 rs11693260 N.D. intronC/G
571369 rs10933605 N.D.byClusterwith2hit intronA/G
571444 rs11680522 N.D. intronG/T
571516 rs62187176 N.D. intronA/C
571573 rs11680576 0.407byClusterbyFreqwith2hit intronC/T
571700 rs11695091 N.D.byClusterwith2hit intronC/G
571747 rs11680677 N.D.byClusterwith2hit intronC/T
571930 rs13430967 N.D.byCluster intron-/C/G
571935 rs13390118 N.D. intronC/G
572617 rs34177490 N.D. intron-/G
572642 rs12469469 N.D.byClusterwith2hit intronC/T
572754 rs2352827 N.D. intronC/T
exon_2573104441 rs11558615 N.D. nonsenseT [Ter[*]]174
contig referenceGGlu [E]174
573180517 rs6717362 N.D. missenseCThr [T]299
contig referenceTMet [M]299
intron_2573249 rs34180864 N.D. intronC/T
573461 rs2352828 N.D. intronC/G
573861 rs6757710 N.D. intronA/G
574130 rs34028191 N.D. intron-/G
574182 rs6437344 N.D.byClusterwith2hit intronC/T
574520 rs11894682 N.D.byCluster intronG/T
575081 rs35165417 N.D. intron-/G
575275 rs35328490 N.D. intronA/G
576091 rs60221599 N.D. intronA/G
576170 rs35971355 N.D. intronA/G
exon_3576277612 rs34976040 N.D. missenseAArg [R]1131
contig referenceGGly [G]1131
576345680 rs1042829 N.D. synonymousTArg [R]3153
contig referenceCArg [R]3153
576487822 rs35343906 N.D. frame shift-1201
contig referenceCPro [P]1201
intron_3577313 rs6748792 N.D. intronA/G
intron_4577549 rs10191531 N.D. intronC/T
577618 rs881029 0.287byClusterbyFreqwith2hitwithHapMapFreq intronA/G
577809 rs6752273 N.D.byClusterwith2hit intronA/G
578040 rs3792219 0.019byFreqwithHapMapFreq intronA/G
578108 rs57964958 N.D. intronA/G
578230 rs3838590 N.D. intron-/C
578561 rs12695020 0.499byClusterbyFreqwith2hitwithHapMapFreq intronA/G
578569 rs12695021 N.D.byClusterwith2hit intronC/T
578580 rs62187178 N.D. intronC/T
578599 rs3830536 N.D.byCluster intron-/ACGCGCGCACACAGGCGTTGACACGCACACGCAGGCGTCA
intron_5578817 rs41266965 N.D. intronC/T
578841 rs13001121 N.D. intronC/T
exon_65789151274 rs34755742 N.D. frame shift-3351
contig referenceGGln [Q]3351
5789211280 rs2229458 0.492byClusterbyFreq synonymousTPro [P]3353
contig referenceCPro [P]3353
exon_75791031361 rs2228327 0.395byClusterbyFreqwithHapMapFreq synonymousTSer [S]3380
contig referenceCSer [S]3380
intron_7579362 rs10188712 N.D.byClusterwith2hit intronA/G
exon_85795181514 rs2228329 N.D.withHapMapFreq synonymousTAsp [D]3431
contig referenceCAsp [D]3431
intron_8579674 rs3177014 N.D. intronC/T
579843 rs2271772 0.154byClusterbyFreqwithHapMapFreq intronC/T
580004 rs10700206 N.D. intron-/G/GTG/T
580005 rs57954246 N.D. intron-/TGG
580058 rs6760745 N.D.byClusterwith2hit intronA/G
exon_95800831670 rs1126920 0.153byClusterbyFreq synonymousTAsp [D]3483
contig referenceCAsp [D]3483
5800891676 rs2228330 0.189byClusterbyFreqwithHapMapFreq synonymousTGly [G]3485
contig referenceCGly [G]3485
5801321719 rs2228331 0.477byClusterbyFreqwithHapMapFreq missenseGGly [G]1500
contig referenceASer [S]1500
5802121799 rs1042841 0.382byClusterbyFreqbySubmitterwith2hitwithHapMapFreq synonymousGGly [G]3526
contig referenceAGly [G]3526
5804682055 rs11892254 N.D.byCluster 3' UTRC/T
5804772064 rs62187180 N.D. 3' UTRA/G
5807912378 rs35036547 N.D. 3' UTRA/G
5808462433 rs3792218 0.005withHapMapFreq 3' UTRC/T
5809842571 rs36203920 N.D. 3' UTRA/G
5809852572 rs3792217 0.173byClusterbyFreqwithHapMapFreq 3' UTRC/T
5811342721 rs13013933 0.061byFreqwithHapMapFreq 3' UTRA/G
5811822769 rs3792216 0.129byClusterbyFreqwithHapMapFreq 3' UTRC/T
5812232810 rs9678753 N.D. 3' UTRA/T
5812532840 rs3792215 0.466byClusterbyFreqwith2hit 3' UTRC/T
5813052892 rs3792214 0.498byClusterbyFreqwith2hitwithHapMapFreq 3' UTRC/G
5813292916 rs35984995 N.D. 3' UTRC/T
5814573044 rs3792213 0.153byClusterbyFreqwith2hit 3' UTRC/G
5815693156 rs3792212 N.D.byClusterwith2hit 3' UTRA/G
5819513538 rs34539825 N.D. 3' UTRC/G
5819743561 rs3749126 0.016byFreq 3' UTRA/T
5820443631 rs3088386 N.D. 3' UTRC/T
5820453632 rs1042823 0.061byClusterbyFreqwith2hitwithHapMapFreq 3' UTRC/T

GENERAL: Contact Us | Homepage | Announcements |dbSNP Summary | Genome | FTP SERVER | Build History | Handle Request
DOCUMENTATION:
FAQ | Searchable FAQ Archive | Overview | How to Submit | RefSNP Summary Info | Database Schema
SEARCH: Entrez SNP | Blast SNP | Batch Query | By Submitter |New Batches | Method | Population | Publication | Batch | Locus Info | Between Marker
HAPLOTYPE:Submission | Specifications | Sample HapSet | Sample Individual
NCBI: PubMed | Entrez | BLAST | OMIM | Taxonomy | Structure

Disclaimer     Privacy statement

Revised: May 25, 2006 1:38 PM .