PubMed  Entrez  BLAST  OMIM  Taxonomy  Structure

Search Entrez NCBI Web site ------------- Books CloneRegistry Domains 3D Domains Gene Genome GEO GEO Datasets HomoloGene Journals MapViewer MeSH Nucleotide OMIM PMC PopSet Protein PubMed SNP Structure Taxonomy UniGene UniSTS for

Entrez UniSTS Help Query tips Submit Submit map FTP site Statistics Related sites e-PCR Map Viewer Gene UniGene dbSNP GeneMap'99 MGD ZFIN Genomic biology Bos taurus Canis familiaris Danio rerio Homo sapiens Mus musculus Rattus novegicus Sus scrofa

UniSTS:63226 Links D12S1042 Homo sapiens chromosome 12, locus C12orf70, polymorphic Pan troglodytes chromosome 12, locus LOC465360 Found by e-PCR in sequences from Homo sapiens and Pan troglodytes. Primer Information Forward primer: TATGACGGTGCACCACATAC Reverse primer: AACCTGCATGGTCTGCATAT PCR product size: 118-136 (bp), Homo sapiens GenBank Accession: G08912    Homo sapiens Name: D12S1042 Also known as: ATA-D12S1042 ATA27A06 CHLC.ATA27A06 CHLC.ATA27A06.P17004 G00-365-024 GDB:683970 Polymorphism info: on genetic map Cross References Gene GeneID: 341346   Symbol: C12orf70   Description: chromosome 12 open reading frame 70   Position: 12p11.23 Mapping Information D12S1042 Sequence Map: Chr 12|HuRef Map Viewer   Position: 27416241-27416374 (bp)   D12S1042 Sequence Map: Chr 12 Map Viewer   Position: 27538639-27538763 (bp)   D12S1042 Sequence Map: Chr 12|Celera Map Viewer   Position: 32792961-32793094 (bp)   D12S1042 deCODE Map: Chr 12 Map Viewer   Position: 50.66 (cM)   ATA27A06 Marshfield Map: Chr 12 Map Viewer   Position: 48.70 (cM)   CHLC.ATA27A06 NCBI RH Map: Chr 12 Map Viewer   Position: 322.1 (cR)   Lod score: 1.35   CHLC.ATA27A06 Whitehead-RH Map: Chr 12 Map Viewer   Position: 183.3 (cR3000)   Lod score: P0.84   CHLC.ATA27A06 Whitehead-YAC Map: Chr 12 Map Viewer   Reference Interval: WC12.1 Electronic PCR results Genomic (5 of 11)[Show All Hits] G08912.1 40 .. 161 (122 bp)   AC068794.25 89604 .. 89728 (125 bp)   AC087257.13 61659 .. 61783 (125 bp)   CH003459.1 31196043 .. 31196176 (134 bp)   CH003507.1 28777627 .. 28777760 (134 bp)     Working Draft phase 1 (from GenBank HTGS division) (2) AC016008.3 12835 .. 12968 (134 bp)   AC021971.3 140332 .. 140456 (125 bp)     Whole Genome Shotgun sequences (4) AADD01122781.1 3621 .. 3754 (134 bp)   AADC01104586.1 155048 .. 155181 (134 bp)   AADB02014753.1 275319 .. 275452 (134 bp)   ABBA01068049.1 9931 .. 10064 (134 bp)        Pan troglodytes Name: D12S1042 Polymorphism info:   Cross References Gene GeneID: 465360   Symbol: LOC465360   Description: hypothetical LOC465360   Position:   Mapping Information D12S1042 Sequence Map: Chr 12 Map Viewer   Position: 61484711-61484832 (bp) Electronic PCR results Genomic (1) CM000326.1 61484711 .. 61484832 (122 bp)     Whole Genome Shotgun sequences (2) AADA01276064.1 12047 .. 12168 (122 bp)   AACZ02135220.1 30322 .. 30443 (122 bp)

Questions or Comments?
Write to the NCBI Service Desk

Disclaimer   Privacy statement