Join Evaluation Legend

Serious alignment problem, requires review. (details...)
- Zero, or more than one, overlaps
- Half dove-tail >50 bp
- Alignment identity <98%
- Alignment length <100 bp
- >2 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Minor alignment problem. (details...)
- Exactly one overlap
- Half dove-tail >0 bp and <=50bp
- Alignment identity <99.1%
- Alignment length <2000 bp
- >0 gaps, each gap >25 bp, not marked as an SSR
- >0 gaps, each gap >50 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, not marked as an SSR
- >0 gaps, each gap >500 bp, marked as an SSR
Excellent alignment, meets all defined criteria. (details...)
- Exactly one RuleInfo
- Half dove-tail <=0 bp
- Alignment identity >=99.1%
- Alignment length >=2000 bp
- <=0 gaps, each gap >25 bp, not marked as an SSR
- <=0 gaps, each gap >50 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, not marked as an SSR
- <=0 gaps, each gap >500 bp, marked as an SSR
Certificate submitted, not yet approved.
Certificate submitted and approved.
Valid, contained clone
Join not evaluated due to one accession not being finished.

Curator Links

Add/Update certificate

Alignment for AL670399.4 and AL663116.7

AL670399.4 Mouse DNA sequence from clone RP23-263M10 on chromosome 11 Contains the 3' end of the Atp2a3 gene for ubiquitous Ca++ transporting ATPase, the P2rx1 and P2rx5 genes for purinergic receptor P2X ligand-gated ion channel 1 and 5, 111 novel genes, the Camkk1 gene for calcium/calmodulin-dependent protein kinase kinase 1 alpha, the Itgae gene for epithelial-associated integrin alpha E, the Gsg2 gene for germ cell-specific gene 2 protein, the gene for a novel protein similar to human tax interacting protein 1, the Ctns gene for nephropathic cystinosis protein and five CpG islands, complete sequence [htgs_phase3]

Length: 224,037 bp

AL663116.7 Mouse DNA sequence from clone RP23-214D6 on chromosome 11 Contains the 5' end of the Ctns gene for nephropathic cystinosis protein, the Carkl gene for carbohydrate kinase-like protein, the gene for the ortholog of human and rat transient receptor potential cation channel subfamily V member 1 TRPV1 and a CpG island, complete sequence [htgs_phase3]

Length: 70,735 bp

Alignment Summary

Join evaluation: green

Alignment count: 1

Go to Endhit Table

Alignment 1
Align ID: 1876
Total Length: 2000
Aligned Length: 2000
Percent Identity: 100
Number of Gaps: 0
Number of Mismatches: 0
Source: CtgOverlap Seq-Align
Valid Switchpoint: true (A)

Alignment 1 of 1

 Mismatches = 0, Gaps = 0, Length = 2000
 Percent identity = 100%
 Score = 3965 bits (2000), Expect = 0
  3 BAC and 4 Fosmid bridging clones.
  3 BAC and 4 Fosmid concordant clones.
  0 BAC and 0 Fosmid discordant clones.

AL670399.4 >222038  aggtcccaggtttcccatttacttgtatgattctggaatacttattaacctatgtttctt 222097 
AL663116.7 >1       ............................................................ 60     

AL670399.4 >222098  aatggggaaacagggacagtggtagttacaccacaggattatagtgagatgaaatacaag 222157 
AL663116.7 >61      ............................................................ 120    

AL670399.4 >222158  gcatacattctcaaaggggctaaaataggctctggaggtctgaaaaaatagctgtaataa 222217 
AL663116.7 >121     ............................................................ 180    

AL670399.4 >222218  ttgcttatctctctcccaaacgtcataataaaaaaaaatagagcttaccagctgtattaa 222277 
AL663116.7 >181     ............................................................ 240    

AL670399.4 >222278  aagtttgaggtggattggtaagataacaaaaagttgagaaacaatgaggtaatgttatta 222337 
AL663116.7 >241     ............................................................ 300    

AL670399.4 >222338  ctattaccacccagggctcccagcaagctctcacagagcatagattgttattttcctcaa 222397 
AL663116.7 >301     ............................................................ 360    

AL670399.4 >222398  tattattgaaaaaggcaagatccaggtaccctctcattctctgggagaatcaacacgagc 222457 
AL663116.7 >361     ............................................................ 420    

AL670399.4 >222458  tcctggaatggtcctagcagaatttacccccaaccccaagttacctacctgcacattcct 222517 
AL663116.7 >421     ............................................................ 480    

AL670399.4 >222518  aagccagattcaggcggcgccacatactgaatagtgccaccaacaccagctgtcagtcgg 222577 
AL663116.7 >481     ............................................................ 540    

AL670399.4 >222578  tgtccgtgcttttgctcaccaacaccctggccctaaaacctagagatgtgcgggcctggg 222637 
AL663116.7 >541     ............................................................ 600    

AL670399.4 >222638  ttggggccagaagctagaaacccaggcgctgcccctctggtagcgtaggttgcccctctg 222697 
AL663116.7 >601     ............................................................ 660    

AL670399.4 >222698  aggtgcggggctaatgtctgttggggtgggtggtgtcataccagaaaagggggtagctgt 222757 
AL663116.7 >661     ............................................................ 720    

AL670399.4 >222758  cccggtcgcgatggttctcacctgacagcttcccaggcttggtggacagacctcaccaaa 222817 
AL663116.7 >721     ............................................................ 780    

AL670399.4 >222818  agcaacaatctcgcaccagaaaccgcttaggagtgtaaggactctctgagctccgccgac 222877 
AL663116.7 >781     ............................................................ 840    

AL670399.4 >222878  tttgtgtgaaagaggggccagctgtcacctgacctgaaccacctgacttgaagccgcgag 222937 
AL663116.7 >841     ............................................................ 900    

AL670399.4 >222938  ccctgtgcaaggagctctggaagttgtagttttcacgaatacaggaggataacgcttggt 222997 
AL663116.7 >901     ............................................................ 960    

AL670399.4 >222998  aggggtgagggaagggtggaagggcggaagagcataggcaccttggcagggacaggggct 223057 
AL663116.7 >961     ............................................................ 1020   

AL670399.4 >223058  cggatgtgaggggcgatctagtctcttgtaggggaagcagggttctcgaagtctctgttg 223117 
AL663116.7 >1021    ............................................................ 1080   

AL670399.4 >223118  tctccttgaagccctgtgctccctggtgaagaccctgggaccccaggcactgtcccggaa 223177 
AL663116.7 >1081    ............................................................ 1140   

AL670399.4 >223178  cctctgaccaatagatcccgccttctgtcgtctctccacctatcaccggaggccgctgtg 223237 
AL663116.7 >1141    ............................................................ 1200   

AL670399.4 >223238  gggagcgcgtggtgtttgctttcctcgaccaatagaagtggttaaaagattgacaaggaa 223297 
AL663116.7 >1201    ............................................................ 1260   

AL670399.4 >223298  gctccgcccccttactgccctccagagtgaagtgttccccggcgtgcggttcaagccacc 223357 
AL663116.7 >1261    ............................................................ 1320   

AL670399.4 >223358  gagctgtgctgtcaccactgccatggcttcgcgacctgtcactctcggtatcgacttggg 223417 
AL663116.7 >1321    ............................................................ 1380   

AL670399.4 >223418  caccacgtccgtgaaggccgccctattggaggctgcacccagcctcccatccgggttcgt 223477 
AL663116.7 >1381    ............................................................ 1440   

AL670399.4 >223478  ggtgctggcgagctgcgcccgggctgcgagggcagagactgagagcgcggtggccgggcc 223537 
AL663116.7 >1441    ............................................................ 1500   

AL670399.4 >223538  ccaggtgaggcagagccctggagctgccgccccgggacgaccctgggggcatctcgggca 223597 
AL663116.7 >1501    ............................................................ 1560   

AL670399.4 >223598  acaccttcccgcgaagaagtacccgtgattgcccagtctgtcggacctccaaggcctgct 223657 
AL663116.7 >1561    ............................................................ 1620   

AL670399.4 >223658  gccctttcctctagggcttcaaagcctgctgcagctcaagctaagccgttagattttgcc 223717 
AL663116.7 >1621    ............................................................ 1680   

AL670399.4 >223718  cagggagctttcccacctgctggcaccgatcttcccgctctccggcttttctggggcccc 223777 
AL663116.7 >1681    ............................................................ 1740   

AL670399.4 >223778  tgaccatggcgctggatccctctactatccgcccatcactttttgtactttgcgccgaga 223837 
AL663116.7 >1741    ............................................................ 1800   

AL670399.4 >223838  ggacttgctttcaaagtgataaccacaggcctgactatcacgctcgccactcatgaccct 223897 
AL663116.7 >1801    ............................................................ 1860   

AL670399.4 >223898  gtgccctctagttcaggcatcatttccgaccccaccccctaggcaggttgtgctctggaa 223957 
AL663116.7 >1861    ............................................................ 1920   

AL670399.4 >223958  atgagacgtagcgttaggcttacctcatgcctttgaagttcaagtaaactgataatttca 224017 
AL663116.7 >1921    ............................................................ 1980   

AL670399.4 >224018  cttggttactcaaagaattc 224037 
AL663116.7 >1981    .................... 2000

Switch Points

Type	Point1	Point2	Orient1	Orient2	Curator	Comment	Time
A	224037	2001	+	+	chenhc	Taxid 10090 chrom 11 Reference assembly	2008-11-20 16:56:51.300

Events

Id	Type	Date	Whodid	Comment
3609	ImportOldDb	09/02/2005 12:44:00	f_old_db
3610	ReSetShortOvlp	09/04/2008 10:31:48	dbo
174495	CreateSwitchPt	11/20/2008 16:56:51	chenhc	tpf_builder 1.6 Toolkit wrapper version: built Nov 19 2008 using /netopt/ncbi_tools64/c++.by-date/20081119/GCC401-Release64/lib

BAC Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
C3H-121P23				AL670399.4	100%	pos 11161 (F+)
C3H-183N24	AL670399.4	99.71%	pos 4548 (R+)
C3H-92D12	AL663116.7	99.71%	pos 60010 (R-)	AL670399.4	100%	pos 118134 (F+)
C3H-92K11	AL663116.7	99.38%	pos 60113 (R-)	AL670399.4	99.47%	pos 117780 (F+)
CH29-168C5	AL670399.4	100%	pos 41704 (R+)
CH29-483I12				AL663116.7	99.37%	pos 15631 (F+)
CH29-512E21	AL670399.4	99.39%	pos 55834 (R-)
CH29-609I20	AL670399.4	99.18%	pos 36694 (R+)	AL670399.4	99.74%	pos 200055 (F-)
CH29-77O20	AL670399.4	99.48%	pos 6267 (R+)	AL670399.4	100%	pos 223964 (F-)
CH29-77O20				AL663116.7	100%	pos 1927 (F-)
RP23-36D22	AL670399.4	99.28%	pos 1030 (R-)
RP24-345M17				AL670399.4	99.07%	pos 112257 (F+)
RP24-360O20	AL670399.4	99.63%	pos 80880 (R-)
RP24-376L13	AL670399.4	99.85%	pos 46860 (R-)

Fosmid Ends

Clone	R			F
Clone	Accession	%id	Position (strand)	Accession	%id	Position (strand)
WI1-1037O21	AL670399.4	100%	pos 159930 (R-)	AL670399.4	100%	pos 120255 (F+)
WI1-1071J17	AL670399.4	99.83%	pos 172288 (R-)	AL670399.4	99.84%	pos 131116 (F+)
WI1-1078G22	AL670399.4	100%	pos 76281 (R+)	AL670399.4	100%	pos 114394 (F-)
WI1-1107H4				AL663116.7	100%	pos 54164 (F+)
WI1-1166P9				AL663116.7	100%	pos 34620 (F+)
WI1-1180K19	AL670399.4	100%	pos 71703 (R-)	AL670399.4	100%	pos 34874 (F+)
WI1-1211M17	AL670399.4	100%	pos 183113 (R+)	AL670399.4	99.71%	pos 222916 (F-)
WI1-1211M17				AL663116.7	99.71%	pos 879 (F-)
WI1-1217N9				AL663116.7	100%	pos 34666 (F+)
WI1-1248K8	AL670399.4	99.84%	pos 71700 (R-)	AL670399.4	100%	pos 34890 (F+)
WI1-133E17	AL670399.4	100%	pos 43456 (R-)	AL670399.4	100%	pos 4188 (F+)
WI1-133K16	AL670399.4	100%	pos 43456 (R-)	AL670399.4	99.69%	pos 4190 (F+)
WI1-1342N19	AL670399.4	100%	pos 221975 (R-)	AL670399.4	99.64%	pos 182399 (F+)
WI1-1409K22	AL670399.4	99.05%	pos 145496 (R+)
WI1-1428I8	AL663116.7	100%	pos 70370 (R+)
WI1-143P19	AL670399.4	99.84%	pos 119940 (R+)	AL670399.4	99.7%	pos 157607 (F-)
WI1-1449L15	AL670399.4	99.61%	pos 31747 (R-)
WI1-1504M23	AL670399.4	99.45%	pos 141770 (R+)	AL670399.4	99.83%	pos 184742 (F-)
WI1-1535H13				AL670399.4	100%	pos 42609 (F-)
WI1-1569H22	AL670399.4	99.67%	pos 200625 (R-)	AL670399.4	100%	pos 161047 (F+)
WI1-1663B9	AL670399.4	99.54%	pos 54094 (R+)	AL670399.4	100%	pos 91521 (F-)
WI1-1689B11	AL670399.4	100%	pos 25042 (R-)
WI1-1692I22	AL670399.4	100%	pos 185530 (R-)	AL670399.4	99.83%	pos 143191 (F+)
WI1-1731P8	AL670399.4	99.57%	pos 180407 (R-)	AL670399.4	99.26%	pos 138441 (F+)
WI1-1744C1	AL670399.4	99.44%	pos 162475 (R+)	AL670399.4	100%	pos 200799 (F-)
WI1-1744M13	AL670399.4	99.83%	pos 162474 (R+)
WI1-1779P22	AL670399.4	99.68%	pos 48619 (R-)	AL670399.4	99.68%	pos 11814 (F+)
WI1-1794O8	AL670399.4	99.84%	pos 11767 (R+)	AL670399.4	99.47%	pos 48165 (F-)
WI1-1832M23	AL663116.7	100%	pos 58869 (R-)
WI1-1890H16	AL670399.4	100%	pos 71062 (R-)	AL670399.4	99.22%	pos 31809 (F+)
WI1-1920G4	AL670399.4	100%	pos 109370 (R-)	AL670399.4	100%	pos 70071 (F+)
WI1-1975F9	AL670399.4	100%	pos 76222 (R+)	AL670399.4	99.64%	pos 115591 (F-)
WI1-198A19	AL663116.7	100%	pos 66207 (R-)	AL663116.7	100%	pos 27601 (F+)
WI1-2005D15	AL670399.4	99.78%	pos 71638 (R-)	AL670399.4	99.74%	pos 33856 (F+)
WI1-2018L9	AL670399.4	100%	pos 147289 (R+)	AL670399.4	99.74%	pos 186423 (F-)
WI1-2038D23	AL670399.4	99.16%	pos 89404 (R-)	AL670399.4	100%	pos 47763 (F+)
WI1-2115E16	AL670399.4	100%	pos 89421 (R-)
WI1-2143E23				AL670399.4	99.85%	pos 23034 (F+)
WI1-2164C16	AL663116.7	100%	pos 42433 (R-)	AL663116.7	99.77%	pos 1686 (F+)
WI1-2183P3	AL670399.4	100%	pos 22927 (R-)
WI1-2188N10	AL670399.4	99.69%	pos 71899 (R-)	AL670399.4	99.31%	pos 35244 (F+)
WI1-2203O13	AL670399.4	100%	pos 204879 (R-)	AL670399.4	100%	pos 165124 (F+)
WI1-2210I1	AL670399.4	99.47%	pos 23030 (R-)
WI1-2256G8	AL670399.4	100%	pos 76493 (R+)	AL670399.4	99.69%	pos 119864 (F-)
WI1-2376J24	AL670399.4	100%	pos 68330 (R+)	AL670399.4	99.61%	pos 108153 (F-)
WI1-2381L12	AL670399.4	100%	pos 155758 (R+)	AL670399.4	100%	pos 192741 (F-)
WI1-2403N5				AL663116.7	100%	pos 41817 (F+)
WI1-2414O20	AL670399.4	100%	pos 204862 (R-)	AL670399.4	100%	pos 165136 (F+)
WI1-2483L21				AL670399.4	99.04%	pos 201816 (F-)
WI1-2488K19	AL663116.7	100%	pos 44850 (R+)
WI1-2539J15	AL663116.7	100%	pos 56024 (R-)	AL663116.7	99.84%	pos 15788 (F+)
WI1-2571G12	AL663116.7	99.41%	pos 44834 (R+)
WI1-2574E6	AL670399.4	99.69%	pos 86980 (R+)	AL670399.4	99.66%	pos 130144 (F-)
WI1-2622P18				AL670399.4	100%	pos 20195 (F-)
WI1-2626N10	AL670399.4	99.48%	pos 71671 (R+)	AL670399.4	99.48%	pos 112323 (F-)
WI1-2667N2	AL670399.4	100%	pos 20803 (R-)
WI1-2711D17				AL670399.4	100%	pos 20195 (F-)
WI1-2749E18	AL670399.4	99.84%	pos 193976 (R+)	AL663116.7	99.82%	pos 11720 (F-)
WI1-2753N8	AL670399.4	99.82%	pos 54432 (R-)	AL670399.4	99.82%	pos 16305 (F+)
WI1-2839F19	AL670399.4	100%	pos 5229 (R+)	AL670399.4	100%	pos 46022 (F-)
WI1-353F8				AL670399.4	100%	pos 20777 (F-)
WI1-376B2				AL663116.7	100%	pos 43332 (F+)
WI1-432E19	AL670399.4	100%	pos 53692 (R-)	AL670399.4	99.84%	pos 15981 (F+)
WI1-441L9	AL670399.4	99.83%	pos 94343 (R-)	AL670399.4	99.82%	pos 57159 (F+)
WI1-466F11				AL663116.7	100%	pos 43327 (F+)
WI1-56I8	AL663116.7	100%	pos 29270 (R-)	AL670399.4	100%	pos 214868 (F+)
WI1-589J11	AL670399.4	100%	pos 153926 (R-)	AL670399.4	100%	pos 113952 (F+)
WI1-593P20				AL670399.4	100%	pos 111833 (F-)
WI1-59A11	AL663116.7	99.56%	pos 29219 (R-)	AL670399.4	99.18%	pos 214869 (F+)
WI1-602F13				AL663116.7	100%	pos 46122 (F-)
WI1-609L11	AL670399.4	100%	pos 214120 (R-)	AL670399.4	100%	pos 177453 (F+)
WI1-645N12				AL670399.4	99.25%	pos 14608 (F-)
WI1-659G5	AL670399.4	100%	pos 108062 (R+)
WI1-792D9	AL670399.4	100%	pos 11048 (R+)	AL670399.4	100%	pos 49858 (F-)
WI1-798D4				AL670399.4	100%	pos 193365 (F+)
WI1-891D15				AL670399.4	99.34%	pos 157614 (F-)
WI1-908J17	AL663116.7	100%	pos 49693 (R-)	AL663116.7	99.39%	pos 10785 (F+)
WI1-911A7				AL670399.4	100%	pos 25169 (F-)

NCBI

Join Evaluation Legend

Curator Links

Alignment for AL670399.4 and AL663116.7

Alignment Summary

Alignment 1 of 1